Labshake search
Citations for GenScript :
51 - 100 of 934 citations for 5 Chloro 1 vinyl 2 pyridone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: The short labelled RNAs 5’ p-LU13-FAM (5’ p-GAGACAGUAUUUG-FAM) and 5’ OH-LU13-FAM (5’ OH-GAGACAGUAUUUG-FAM) were chemically synthesized by Genscript Biotech Corporation ...
-
bioRxiv - Synthetic Biology 2022Quote: ... carrying 5’-GCAATGCGTATCATTCTGCT and 5’-GCCGTCAACTTTCGCGTATT guide sequences (from GenScript USA Inc.). Positive colonies were selected by screening colonies with allele-specific PCR (Supplementary Table 4 ...
-
bioRxiv - Immunology 2023Quote: sgRNAs (PD-L1: 5’TCTTTATATTCATGACCTAC; CD155: 5’CCCGAGCCATGGCCGCCGCG) were chemically synthesized (GenScript). Ribonucleoproteins (RNPs ...
-
bioRxiv - Immunology 2021Quote: ... chimeric group 1 or group 2 stalk proteins expressed in Sf9 cells were column purified (GenScript). For functional assays and luminex Fc receptor binding and titer ...
-
bioRxiv - Cell Biology 2023Quote: ... rabbit anti-Akr1B-2 at 1:100,000 (produced to full-length Drosophila p23 (Q9VH95) by GenScript) and mouse anti-α-Tubulin at 1:5000 (AB_477593 ...
-
bioRxiv - Immunology 2023Quote: ... were coated with 1 μg/mL (for IgG) or 5 μg/mL (for IgA) S-2P protein (GenScript), corresponding to the spike protein of the Wuhan-Hu-1 virus stabilized with 2 proline mutations ...
-
bioRxiv - Biochemistry 2024Quote: ... The FAM-labeled fluorescent FTH-1 IRE probe with the sequence 5’- UCCUGCUUCAACAGUGCUUGGACGGAAC-3’ was prepared by GenScript Biotech (Netherlands) ...
-
bioRxiv - Cell Biology 2021Quote: ... Three human codon-optimized As-NF-κB (named 1, 2, and 3) cDNAs were synthesized by GenScript based on sequences from the transcriptome of A ...
-
bioRxiv - Microbiology 2021Quote: ... N501Y.V1 (Variant 1) mutant Spike proteins of SARS-CoV-2 were codon-optimized and synthesized by GenScript Inc (Nanjing ...
-
bioRxiv - Plant Biology 2024Quote: ... Guide RNA sequences “5-CGUGUCACGACGGAGUGGAU-3” and “5-AUGUUGUAUGUGCCUAUACG-3” were synthesized by GenScript by adding the Cas12a scaffold sequence (5-UAAUUUCUACUCUUGUAGAU-3 ...
-
bioRxiv - Cell Biology 2021Quote: ... (5) was synthesized by GenScript and subsequently subcloned into the respective restriction sites of pcDNA4/TO-CLC7-Y715C ...
-
bioRxiv - Cell Biology 2023Quote: ... Primary antibodies were dissolved in 5% BSA (Biofroxx, 4240GR005) and the dilutions were: Streptavidin-HRP (1:2000, GenScript, M00091), RL2 (1:1000 ...
-
bioRxiv - Bioengineering 2024Quote: ... Stiff elastic (50 kPa) NorHA hydrogel precursor solutions (5 wt% NorHA) containing 1 mM thiolated RGD peptide (GCGYGRGDSPG, Genscript) and dithiothreitol (DTT ...
-
bioRxiv - Developmental Biology 2021Quote: ... The loaf sgRNA sequences GCTGGTGATTACGTCGGTGA (loaf gRNA 1) and TGCGGGACCATCCGGGTACC (loaf gRNA 2) identified on www.flyrnai.org/crispr2 were made with gene synthesis in pUC57 (GenScript) and cloned into pCFD4 (Port et al ...
-
bioRxiv - Immunology 2023Quote: ... 50 μl of phycoerythrin (PE)– conjugated human angiotensin-converting enzyme 2 (ACE2) (hACE2; 1 μg per milliliter; GenScript) was added to the well and incubated for 30 minutes at 37°C with agitation ...
-
bioRxiv - Neuroscience 2024Quote: ... and FAT-2 (Genscript) cDNAs were amplified with PCR and subcloned into the pHR-hSyn-EGFP vector (Addgene #114215 ...
-
bioRxiv - Biochemistry 2024Quote: ... The RNA (5’-UCGCUUGGUGCAGAUCGGGAC-3’) labeled at the 5’ end with FAM was synthesized by Genscript co. ...
-
bioRxiv - Microbiology 2021Quote: The ability of aptamers to block the association of SARS-COV-2 RBD with ACE-2 was measured with the cPass™ SARS-CoV-2 Neutralization Antibody Detection kit (GenScript®). For comparison ...
-
bioRxiv - Biochemistry 2020Quote: ... Recombinant SARS-CoV-1 spike protein was obtained from SinoBiological and SARS-CoV-2 spike was obtained from Genscript and Acro Biosystems.
-
bioRxiv - Immunology 2022Quote: ... A codon-optimized version of the full-length spike gene of the Wuhan-1 SARS-CoV-2 strain (MN908947.3; GenScript) was cloned into the Monogram proprietary env expression vector ...
-
bioRxiv - Plant Biology 2021Quote: ... The supernatant was collected and incubated for 1 h with 2 ml of 50% slurry of Glutathione Resin (Genscript) before loading onto an empty EconoPac gravity-flow column (Bio-Rad Laboratories ...
-
bioRxiv - Biophysics 2024Quote: Gene sequences for nsp7-11 and Mpro used were taken from “Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1” as published in January 2020 (replaced by NCBI LOCUS NC_045512) and commercially synthesized (GenScript). The synthetic gene sequence for nsp7-11C and nsp7-11N with suitable overhangs were cloned with Type IIS restriction enzymes into either pASK35+ and pASK33+ (IBA life sciences) ...
-
bioRxiv - Immunology 2022Quote: Human codon-optimized sequences of the ectodomain of SARS-CoV-2 spike protein (Wuhan Hu-1 complete genome, GenBank: MN908947.1) was synthesized by GenScript, Piscataway ...
-
bioRxiv - Microbiology 2024Quote: The set 1 and set 2 pooled sgRNA oligos were synthesized as one oligo chip by GenScript (Nanjing, China), and the oligo sequences were listed in Supplementary Table S4 ...
-
bioRxiv - Immunology 2024Quote: Antibodies were then purified using 1- to 2-mL of protein A or G resin (Genscript L00210 and L00209) with gravity columns (Bio-Rad 7321010) ...
-
bioRxiv - Neuroscience 2023Quote: ... # E7) in 5% non-fat milk TBST and FOLR1 antibody in 5% non-fat milk TBST (GenScript). Anti-GFP antibody or normal rabbit IgG were used as controls in FOLR1-CD2AP co-IP experiments.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... SARS-CoV-2 pseudovirus (Genscript) was diluted in DMEM complete media to an IFU of 3.2e7/mL ...
-
bioRxiv - Microbiology 2021Quote: ... ACE-2 –Fc (GenScript Z033484) was diluted at 1.2µg/ml in HBS P+ (Cytiva ...
-
bioRxiv - Plant Biology 2020Quote: ... three separated segments (excluding the TCP domain) from the COM1 gene each containing 300-360 bp were synthesized (probe 1 and 2, GenScript Biotech ...
-
bioRxiv - Biophysics 2020Quote: ... Recombinant nucleocapsid protein of SARS-CoV-2 (Catalog No: Z03488- 1) and SRPK1 kinase (Catalog No: PV4215) were purchased from GenScript andThermoFisher ...
-
bioRxiv - Immunology 2022Quote: ... human codon-optimized cDNA encoding SARS-CoV-2 spike glycoprotein of the WA-1/2020 and variants were synthesized by GenScript and cloned into eukaryotic cell expression vector pcDNA 3.1 between the BamHI and XhoI sites ...
-
bioRxiv - Immunology 2021Quote: ... were coated with 100 µL of SARS-CoV-2 RBD (1 µg/mL) (cat n° Z03479, GenScript, Piscataway, NJ, USA) and S1 subunit (0.5 µg/mL ...
-
Activation of endoplasmic reticulum stress via clustering of the inner nuclear membrane protein SUN2bioRxiv - Cell Biology 2022Quote: ... and SUN2-N-2 (AA 1-226) fragments by PCR from pcDNA3.1+/C-(K)DY-SUN2 vector (OHu01874,GenScript # NM_001199579.1) and subsequent cloning into MP029-CRY2-mCherry lentiviral vector using the NheI/XbaI restriction sites ...
-
bioRxiv - Immunology 2022Quote: ... for 30 minutes before adding 100 ng/mL of Sars-CoV-2 spike protein (RBD, HisTag) (Cat. ZO3483-1-GenScript) or infected using Heat-inactivated SARS-CoV-2 (VR-1986HK ...
-
bioRxiv - Cell Biology 2020Quote: ... Ctdnep1-GFP and Ctdnep1 _D67E-GFP siRNA resistant sequences adding silent mutations for Ctdnep1 siRNAs #1 and #2 were synthesized (GenScript) and cloned directly to pcDNA3.1(+)-C-eGFP vector.
-
bioRxiv - Microbiology 2020Quote: The SARS-CoV-2 S gene from the Wuhan-Hu-1 isolate (GenBank: MN908947.3) was codon optimized (Genscript, Township, NJ) and cloned in pMD2iPuror in EcoRI/XhoI ...
-
bioRxiv - Microbiology 2022Quote: ... pcDNA3.1 encoding CoV-2 Omicron (BA.1) Spike tagged with a His epitope on the N-terminus was synthesized provided by Genscript. pMD2.G encoding VSV-G (12259 ...
-
bioRxiv - Immunology 2022Quote: ... for 30 minutes before being exposed with 100 ng/mL of Sars-CoV-2 spike protein (RBD, HisTag) (Cat. ZO3483-1-GenScript) at different times (5 ...
-
bioRxiv - Microbiology 2022Quote: ... was assembled from a PCR performed on a codon-optimized SARS-CoV-2 Omicron BA.1 sequence synthesized by Genscript. Fragments were assembled with a PCR fragment containing the fpl and mNG2(11 ...
-
bioRxiv - Microbiology 2022Quote: ... were stimulated for 24 h with 15-mer overlapping peptides from SARS-CoV-2 spike glycoprotein (Cat no# PM-WCPV-S-1, JPT Peptide Technologies GmbH) or VSV-N (Genscript) at a concentration of 2.5 µg/mL ...
-
bioRxiv - Molecular Biology 2024Quote: ... Slot-RL and the recoded versions of pEGFP (pEGFP-1, EGFP-2), pRL (pRL1, pRL2 and pRL3) and N (p5’L-N1, pN1) were obtained from GenScript.
-
bioRxiv - Cancer Biology 2024Quote: Gene blocks containing three fragments of the long isoform of NAB2-STAT6 (exons 1-4 of NAB2 and exons 2-22 of STAT6) with a c-terminal FLAG tag were ordered from GenScript. Using Gibson Assembly® Master Mix (NEB ...
-
bioRxiv - Biophysics 2020Quote: Mouse 5-HT3AR gene (purchased from GenScript) and mutant genes were inserted into pTLN plasmid ...
-
bioRxiv - Biophysics 2023Quote: ... either labeled with 5’ 6-carboxyfluorescein or unlabeled and reverse complement 14mer (5’-GACGUCCAUGUGCC-3’) were purchased from GenScript. The dsRNA was prepared by annealing the ss-14mer (5’-GGCACAUGGACGUC-3’ ...
-
bioRxiv - Microbiology 2020Quote: ... were coated overnight at 4°C with 2μg/ml of recombinant SARS-CoV-2 S1-RBD protein (GenScript No. Z03483-1) in carbonate-bicarbonate buffer (Sigma Aldrich No ...
-
Development of monoclonal antibody-based blocking ELISA for detecting SARS-CoV-2 exposure in animalsbioRxiv - Microbiology 2023Quote: ... The SARS-CoV-2 full-length N gene of Wuhan-hu-1 isolate (GenBank # NC 045512.2) was synthesized (GenScript, Piscataway, NJ) and cloned in the pET-28a (+ ...
-
bioRxiv - Biophysics 2020Quote: ... Region +95 to +374 containing (linker-Spinach 2-linker-Spinach 2-linker) was synthesized by GenScript as double stranded DNA delivered on a pUC57 plasmid ...
-
bioRxiv - Systems Biology 2021Quote: ... and 2 were synthesized by Genscript. RTKs were cloned into MAC-TAG-C expression vector (Liu et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... Angiopep-2 was obtained from GenScript. Puromycin dihydrochloride ...
-
bioRxiv - Immunology 2020Quote: ... Pseudotyped SARS-CoV-2-S (Genscript), full-length recombinant S protein (Acrobio systems) ...