Labshake search
Citations for GenScript :
51 - 100 of 613 citations for 5 2 3 Difluorophenyl 5 oxovaleric acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... Peptide-pulsing of target cells was performed by incubating EBV-LCLs in FBS-free medium at a density of 5×106 cells/ml for 2 hours in the presence of individual peptides (107 pg/ml, Genscript). After an overnight incubation ...
-
bioRxiv - Biochemistry 2021Quote: ... ATAD1 was diluted in 2-fold dilution series and incubated with 100 nM fluorescently-labeled peptide (P13: 5-FAM-FSRLYQLRIR, purchased from Genscript) for 20 minutes at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... and Omicron BA.5 spike were based on the codon-optimised spike sequence of SARS-CoV-2 and were generated by GenScript Inc ...
-
bioRxiv - Biophysics 2020Quote: ... Synthetic DNAs were purchased as GeneBlocks from IDT (5’ leader constructs) or as Gene Parts from GenScript (5’UTR constructs). All synthetic DNAs had a 5’-terminal XmaI consensus sequence and 3’-terminal HindIII consensus sequence ...
-
bioRxiv - Cell Biology 2023Quote: All peptides used for binding assays (Data S1) were synthesized with a N-terminal 5-carboxyfluorescien (5-FAM) at >85% purity (GenScript); peptides used for competition studies did not have 5-FAM ...
-
bioRxiv - Bioengineering 2023Quote: ... soluble RGD (5 mM RGD peptide, GCGYGRGDSPG, Genscript) was added to media in the 3% experimental group and outgrowth after 3 days was compared to PBS controls ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 μg of DBR1 expression vector (GenScript, OHu11162) was transfected into cells using Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Developmental Biology 2023Quote: ... were also commercially synthesized with 5’EcoRV and 3’SpeI ends and cloned into the pCDNA3.1 vector by Genscript (Genscript USA, Piscataway, NJ). To construct the inducible GR-RFX6 wild type or mutants used in cycloheximide direct target assays ...
-
bioRxiv - Immunology 2024Quote: ... custom 15mer OLPs with 11 amino acid overlap were generated spanning the SARS-CoV-2 Spike RBD WH-01 protein (amino acids R319-S591, GenScript). WH-01 peptides that contained VOC mutation loci were substituted with the corresponding mutant sequences when applicable ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 ug protein samples were boiled at 90°C for 5 minutes in LDS sample buffer (Genscript#M00676 or Millipore#MPSB) containing 5% 2-mercaptoethanol ...
-
bioRxiv - Bioengineering 2021Quote: ... and 5 mM RGD peptide (Ac-RGDSPGERCG-NH2, Genscript) in PBS at a rates of 0.5 - 5 µL/min ...
-
bioRxiv - Cell Biology 2024Quote: ... The supernatant was mixed with 5× sample buffer (GenScript), heated to 100°C for 10 min ...
-
bioRxiv - Biochemistry 2024Quote: ... and the supernatant was loaded onto a gravity Ni-NTA column (2-5 ml Ni-charged resin FF from GenScript, Cat# L00666-25). The Ni-NTA column was washed and then the His-tag fused protein was eluted using step-gradient of imidazole (50 ...
-
bioRxiv - Immunology 2022Quote: ... Omicron BA.1 and BA.5 was performed by GenScript, Nanjing ...
-
bioRxiv - Bioengineering 2022Quote: ... The rat Arc 5’ UTR sequence was synthesized by Genscript. Molecular cloning techniques (PCR amplification ...
-
bioRxiv - Biochemistry 2024Quote: hOrc1-5 expression plasmids were generated by gene synthesis (Genscript) based on pESC vectors (Stratagene ...
-
bioRxiv - Microbiology 2024Quote: ... A high purity Hst-5 peptide was synthesized by GenScript and Hst-5 specific rabbit polyclonal antibody was produced by Lampire Biological Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Microbiology 2024Quote: ... The 2-mer and 3-mer oligos were ordered from GenScript USA ...
-
bioRxiv - Biochemistry 2022Quote: ... YedK peptide consisting of the amino acids 2-16 (CGRFAQSQTREDYLA) was synthesized by Genscript. 50 nM 5’-FAM-labeled AP-DNA (FAM_U_20 ...
-
bioRxiv - Immunology 2021Quote: ... One million cells per well were added to a U-bottom 96-well plate and were stimulated with 5 μg/ml of pools of overlapping SARS-CoV-2 S protein peptides (GenScript USA Inc, Piscataway, NJ). The stimulation was performed by incubation for 6 h at 37°C and 5% CO2 in the presence of Protein Transport Inhibitor Cocktail (brefeldin A ...
-
bioRxiv - Cancer Biology 2021Quote: ... The custom polyclonal p-Smurf2Thr249 antibody was generated (#J1683BA260-5) (GenScript). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... All AtLEA4-5 Scrambled ORFs were synthesized as gene fragments (Genscript).
-
bioRxiv - Evolutionary Biology 2022Quote: Protein G (5 μg/ml, 50 μl/well; Genscript, China, Z02007) was diluted to 5 μg/ml with PBS (0.01 M ...
-
bioRxiv - Immunology 2022Quote: ... 5 μl synthetic antigen peptide (Genscript, 0.2 mg/ml in PBS), or 5 μl heat-killed bacteria in PBS ...
-
bioRxiv - Physiology 2024Quote: ... The protein samples were mixed with 5× sample buffer (MB01015; GenScript, US) and subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) ...
-
bioRxiv - Biochemistry 2024Quote: ... were coated with 20 µl 5 µg/mL Protein A (Genscript, Z02201) in 100 mM sodium bicarbonate pH 9.6 at 4°C overnight ...
-
bioRxiv - Cancer Biology 2021Quote: ... The primary antibodies used were, anti-p-Smurf2Thr249 (#J1683BA260-5, 1:2000) (GenScript), anti-Phospho-Smad2 (Ser465/467 ...
-
bioRxiv - Immunology 2021Quote: ... cells were stimulated ex vivo with 5 μg/mL OVA257-264 peptide (GenScript) for 4 hours in the presence of Golgi stop (BD Biosciences ...
-
bioRxiv - Cell Biology 2021Quote: ... Cultures were blocked by addition of 5 μg/ml of α factor (GenScript) every 90 min in YPAD until <10% cells were budded ...
-
bioRxiv - Immunology 2022Quote: ... 5 μl of a synthetic antigen peptide (Genscript, 0.2 mg/ml in PBS), eBioscience Cell Stimulation Cocktail (Fisher Scientific 00-4975-93 ...
-
bioRxiv - Molecular Biology 2020Quote: ... blocked with 5% milk and probed with C-Myc antibody (Genscript A00173-100), Rad53 antibody (Abcam ab104232) ...
-
bioRxiv - Biochemistry 2021Quote: ... CENP-T was fluorescently labeled with a GGGGK-TMR (5-Carboxytetramethylrhodamine) peptide (GenScript) using the Calcium-independent Sortase 7M (Hirakawa et al. ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... the samples were boiled in 5 х Loading Buffer (GenScript, Piscataway, NJ, USA) and subjected to SDS-PAGE or immunoblotting with indicated antibody.
-
bioRxiv - Microbiology 2021Quote: ... a synthetic 999 bp fragment of the recodonized version of the CpMetRS (starting from amino acid number 247) along with the 3’UTR sequence of the enolase gene (cgd5_1960) was purchased (GenScript, NJ, USA). The synthetic construct was PCR amplified to introduce desired mutations and the 5’ homology region was introduced as an overhang in the forward primer ...
-
bioRxiv - Immunology 2022Quote: ... A total of 500,000 splenocytes were restimulated ex vivo with the full-length SARS-CoV-2 B.1.1.529 S 15-mer (overlapping by 11 amino acids) peptide pool (GenScript) in plates pre-coated with anti-IFN-γ or anti-IL-4 antibodies ...
-
bioRxiv - Immunology 2021Quote: 15-mer peptides that are overlapping by 10 amino acids (AA) spanning the entire SARS-CoV-2 Spike protein (GISAID EPI_ISL_410713) were synthesized (Genscript) and pooled into 7 pools of approximately 40 peptides in each pool (Supplementary Table 1) ...
-
bioRxiv - Microbiology 2022Quote: ... 10^5 splenocytes were seeded and stimulated with peptides against S protein (From GenScript) (2μg/ml ...
-
bioRxiv - Microbiology 2021Quote: ... and JPS-G3 VHHs [20] separated by 15-amino acid flexible glycine-serine linkers ((GGGGS)3) was synthesized (GenScript Biotech, Piscataway, NJ) and ligated into pET32b(+ ...
-
bioRxiv - Biochemistry 2020Quote: SARS-CoV-2 nsp12 gene (amino acid 4393-5324 Uniprot: P0DTD1) was synthesized de novo by GenScript (Nanjing, China) and constructed onto pET22b vector between NdeI and XhoI sites ...
-
bioRxiv - Molecular Biology 2023Quote: ... Afp18N20EtA (Afp18N20EtA: MPYSSASKAKATHSKATARD, glutamic acids to alanines) were synthesized and subcloned into pET11a_afp18NT20-casΦ-2 (replacing afp18NT20) by Genscript.
-
bioRxiv - Immunology 2022Quote: ... Samples were stimulated using pooled Spike peptides of SARS-CoV-2 (Final concentration:1μg/mL, 15-mer peptide with 11 amino acids covering the spike region, Genscript) and cultured at 37°C with 5% CO2 for 20 h ...
-
bioRxiv - Genetics 2023Quote: ... The Klf2 genomic fragment from intron 2 to the exon 3 untranslated region was synthesized (GenScript) and cloned into the HindIII-SbfI site of pPGKneo-F2F-Klf2-5HR located at the opposite side of the NotI site with respect to the neo cassette ...
-
bioRxiv - Biochemistry 2022Quote: ... for >5 min at room temperature and incubated with mouse anti-His antibody (Genscript A00186) at 0.1 µg/ml in EveryBlot buffer for 1 hr at room temperature or overnight at 4 °C ...
-
bioRxiv - Biophysics 2020Quote: The gene corresponding to residues 1-201 of colicin 5 (colE5-T) was synthesized (GenScript) and cloned into pET21(+ ...
-
bioRxiv - Genomics 2023Quote: ... rs74745580) were generated in the 5′ UTR-Flag-COMT-moxGFP clone in pDEST_HC_Rec_Bxb_v2 by Genscript. The 5′ UTR mutants were generated using the NEB Q5 Site-Directed Mutagenesis Kit (Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... Peptide pools consisted of 15-mer peptides overlapping by 11 amino acids and spanned the entire S and N proteins of SARS-CoV-2 (GenScript). After stimulation ...
-
bioRxiv - Immunology 2021Quote: ... The splenocytes were stimulated for 20 hours at 37°C with RBD peptides (15-mer peptides overlapping by 9 amino acid spanning the RBD of SARS-CoV-2 spike protein, GenScript), at 5μg/mL of each peptide in RPMI + 10% FBS (R10) ...
-
bioRxiv - Immunology 2022Quote: ... Peptide pools consisted of 15-mer peptides overlapped by 11 amino acids and spanning the entire S and N proteins of SARS-CoV-2 (GenScript). After stimulation ...
-
Sterilizing immunity against SARS-CoV-2 in hamsters conferred by a novel recombinant subunit vaccinebioRxiv - Microbiology 2020Quote: ... cells were incubated with pooled peptides of SARS-CoV-2 spike (15-mer peptides with 11 amino acids overlap, cover the entire spike protein, Genscript) and cultured for 20 hours ...