Labshake search
Citations for GenScript :
51 - 100 of 1164 citations for 3 Hydrazino 5 methyl 4H 1 2 4 triazol 4 ylamine hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... Human OTUD4 (isoform 4 NP_001352986.1) was purchased from GenScript. Human OTUD4 constructs were cloned without tag or with FLAG-tag into the expression plasmid pcDNA3.1 (Life technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... Three human codon-optimized As-NF-κB (named 1, 2, and 3) cDNAs were synthesized by GenScript based on sequences from the transcriptome of A ...
-
bioRxiv - Biochemistry 2024Quote: ... The FAM-labeled fluorescent FTH-1 IRE probe with the sequence 5’- UCCUGCUUCAACAGUGCUUGGACGGAAC-3’ was prepared by GenScript Biotech (Netherlands) ...
-
bioRxiv - Plant Biology 2020Quote: ... coli (Supplementary Table 4) and synthesized by GenScript (Piscataway, NJ). The Arabidopsis THI4 sequence was the native cDNA ...
-
bioRxiv - Cell Biology 2020Quote: ... Polyacrylamide gel (SurePAGE™, 4-20%) was bought from Genscript Biosciences (Nanjing ...
-
bioRxiv - Microbiology 2022Quote: SDS-PAGE analyses were performed using 4-12% SurePAGE (Genscript), the precast mini polyacrylamide gels ...
-
bioRxiv - Neuroscience 2022Quote: ... The proteins were separated by 4-20% SDS-PAGE (GenScript) and transferred onto PVDF membranes(Amersham) ...
-
bioRxiv - Biophysics 2020Quote: ... and then resolved on 4%-20% Bis-Tris gels (GenScript). The gels were stained with Coomassie brilliant blue and imaged with Image Lab 3.0 (Bio-Rad).
-
bioRxiv - Cell Biology 2022Quote: ... Interleukin-4 (catalog #Z02996) was purchased from GenScript (Piscataway, NJ). Reduced glutathione (catalog #G6529 ...
-
bioRxiv - Biochemistry 2024Quote: ... SDS-PAGE (SurePAGE™, Bis-Tris, 10ξ8, 4-12%, GenScript) was used to assess protein purity ...
-
bioRxiv - Microbiology 2024Quote: Samples were separated on 4-12% Bis-Tris gels (Genscript) in Tris-MOPS-SDS running buffer (Genscript M00138 ...
-
bioRxiv - Cell Biology 2024Quote: Proteins were separated on 4-12% SDS-PAGE gels (GenScript) and transferred to PVDF membrane (0.2 μm ...
-
bioRxiv - Biochemistry 2024Quote: ... The RNA (5’-UCGCUUGGUGCAGAUCGGGAC-3’) labeled at the 5’ end with FAM was synthesized by Genscript co. ...
-
bioRxiv - Neuroscience 2022Quote: ... basic and Methyl-mimic mutants were synthesized by Genscript with N-terminal NheI and C-terminal Acc65I restriction enzyme site s flanking the DUX4 ORF ...
-
bioRxiv - Developmental Biology 2022Quote: ... Transferred membranes were incubated with the following primary antibodies overnight at 4°C: DUXBL (1:1000, Custom antibody, GenScript), ZSCAN4C (1:500 ...
-
bioRxiv - Biochemistry 2020Quote: ... Proteins were separated in 4-20% gradient precast PAGE gels (Genscript) and stained by Coomassie blue.
-
bioRxiv - Microbiology 2022Quote: ... Protein samples were separated by 4– 12% gradient SDS-PAGE (GenScript) and blotted onto nitrocellulose or PVDF membranes ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and loaded onto a 4 – 12% gradient SDS-PAGE gel (Genscript) for electrophoresis ...
-
bioRxiv - Systems Biology 2020Quote: ... resolved on a 4-20% gradient ExpressPlus™ PAGE gels (GenScript) and transferred to PVDF membranes (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were loaded on 4–20% polyacrylamide gradient gels (#M42015, GenScript), according to the guidelines of the manufacturer ...
-
bioRxiv - Neuroscience 2023Quote: ... and on 4-20% polyacrylamide gels (GenScript® Express Plus PAGE) in Tris-MOPS-SDS running buffer (GenScript® Running Buffer Powder ...
-
bioRxiv - Cell Biology 2024Quote: ... Proteins were separated on 4-12% gradient precast SurePAGE gels (GenScript), and subsequently transferred to nitrocellulose membranes (Amersham Bioscience ...
-
bioRxiv - Bioengineering 2024Quote: ... proteins were separated on 4–12% SurePAGE gradient gel (M00725, GenScript), transferred to Immobilon-P PVDF membrane (IPVH00010 ...
-
bioRxiv - Cell Biology 2024Quote: ... were separated via SDS-PAGE using 4-12% Bis-Tris (Genscript) in 1X MES Running Buffer (Genscript ...
-
bioRxiv - Molecular Biology 2024Quote: ... The samples were separated by 4-20% SurePAGE™ Gel (GenScript) for 1 h at 140V and then transferred to PVDF membranes for 2 h at 75V ...
-
bioRxiv - Plant Biology 2021Quote: cDNA stretches corresponding to the 3’ UTR region of TCV genomic RNA (5’-CAACUGAGGAGCAGCCAAAGGGUAAAUUGCAAGCACUCAGAAU-3’) were obtained from GenScript [26] ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Microbiology 2024Quote: ... The 2-mer and 3-mer oligos were ordered from GenScript USA ...
-
bioRxiv - Developmental Biology 2023Quote: ... Mouse Meis2 isoform D (4) (the tag was removed) and Lhx6 variant 1 (C-DYK) expressing vectors were purchased from Genscript, Dlx5 and Pbx1 coding sequences were amplified from mouse cDNA and cloned into pcDNA3.1 (Genscript) ...
-
bioRxiv - Cell Biology 2020Quote: ... and resolved on a 4-12% Bis-Tris polyacrylamide gradient gel (Genscript). Proteins were transferred to PVDF membranes and immunodetection of respiratory chain complexes was performed using the Total OXPHOS Blue Native WB Antibody Cocktail (Abcam ...
-
bioRxiv - Bioengineering 2021Quote: ... The mixtures were subsequently separated by 4–20% SDS-PAGE Gel (GenScript) and transferred to poly-vinylidene fluoride (PVDF ...
-
bioRxiv - Biochemistry 2020Quote: ... Extracted proteins were separated in 4-20% precast gradient PAGE gels (Genscript) and transferred to PVDF membranes for immunoblot ...
-
bioRxiv - Neuroscience 2020Quote: ... Using SurePAGE 4-12% bis-tris gels (GenScript, Piscataway, NJ; cat # M00653), 40μl of protein sample was loaded into each well and run at 200V for roughly 1.5 hours in Tris-MOPS-SDS running buffer (GenScript ...
-
bioRxiv - Biochemistry 2022Quote: ... using SurePAGE 4-20% gradient Bis-Tris gels (Genscript, Picastaway, NJ, USA) under reducing conditions ...
-
bioRxiv - Immunology 2022Quote: ... 4) TCRβ-CD3δ crosslinking: mouse anti-V5 and rabbit anti-FLAG (Genscript); 5 ...
-
bioRxiv - Immunology 2021Quote: ... 10 mg of β2-microglobulin and 4 mg of YLQ peptide (Genscript). Soluble YLQ-SG3 TCR was produced by refolding 50 mg of TCRα chain with 50 mg of TCRβ chain ...
-
bioRxiv - Bioengineering 2023Quote: Protein samples were separated at 150 V in 4% - 20% SurePage (Genscript) polyacrylamide gels using MOPS-SDS running buffer and 1x NuPAGE LDS sample buffer ...
-
bioRxiv - Microbiology 2023Quote: ... Protein extracts were resolved in an ExpressPlus 4-12% gradient gel (GenScript), electroblotted to a nitrocellulose membrane ...
-
bioRxiv - Biochemistry 2023Quote: ... The samples were loaded on Bis-Tris gradient gels (4-20%, Genscript) and run using Tris-MOPS buffer at 60 mA/200 V ...
-
bioRxiv - Biochemistry 2023Quote: ... The cell lysates were separated by 4-20% SDS-PAGE (GenScript M00657) and transferred to a nitrocellulose membrane (0.45 µm ...
-
bioRxiv - Biochemistry 2024Quote: ... GII.4 RdRp-NΔ51 for bacterial expression were also generated by Genscript U.S.A ...
-
bioRxiv - Immunology 2020Quote: ... plasmid that contained predesigned guide RNA targeting Adar1 (5’-CTTGTCCGTCAAGTACCAGA-3’) and a pLentiCRISPR v2 plasmid that contained predesigned guide RNA targeting Adar2 (5’-AGTACCGCCTGAAGAAGCGA-3’) were obtained from GenScript. These plasmids were then transfected into Raw 264.7 cells using a Neon Transfection System (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2023Quote: ... either labeled with 5’ 6-carboxyfluorescein or unlabeled and reverse complement 14mer (5’-GACGUCCAUGUGCC-3’) were purchased from GenScript. The dsRNA was prepared by annealing the ss-14mer (5’-GGCACAUGGACGUC-3’ ...
-
bioRxiv - Microbiology 2021Quote: ... succinimidyl ester)-LPSXG-(5-[(2-aminoethyl)amino]naphthalene-1-sulfonic acid) (Edans) peptides were provided by GenScript (Piscataway, NJ). Six peptide sequences were selected for study ...
-
bioRxiv - Microbiology 2024Quote: ... followed by staining of cells with primary rabbit anti-SARS-CoV-2 N Wuhan-1 antibody (Genscript U739BGB150-5) (1:2000 dilution ...
-
bioRxiv - Molecular Biology 2020Quote: ... The selected sgRNA with additional 20 bp RP-loop [5’TCTCCCTGAGCTTCAGGGAG-3’] at the 5’ end of guide RNA was custom synthesized by Genscript, cloned into plasmid pUC57 with unique restriction sites (Pcil ...
-
bioRxiv - Evolutionary Biology 2020Quote: The gene encoding 4-hydroxybutyryl-CoA dehydratase (4HBD; Nmar_207) was purchased from Genscript Biotech (codon-optimized with cleavable N-terminal hexa-Histidine tag) ...
-
bioRxiv - Biochemistry 2020Quote: ... SDS-PAGE analysis was performed on precast 4-20% gradient gels (GenScript, USA) in a Tris-MOPS buffered system under reducing conditions according to manufacturer guidelines ...
-
bioRxiv - Biochemistry 2021Quote: ... Samples were separated on a 4-12% ExpressPlus™ PAGE gel (GenScript #M41212) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... The extracts were fractionated on a 4-20% ExpressPlus™ PAGE gel (Genscript) using SDS-MOPS buffer and transferred onto nitrocellulose membrane (BioTrace™ NT Nitrocellulose transfer membrane ...