Labshake search
Citations for GenScript :
51 - 100 of 789 citations for 3 2 5 Dioxoimidazolidin 4 yl propanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... Three human codon-optimized As-NF-κB (named 1, 2, and 3) cDNAs were synthesized by GenScript based on sequences from the transcriptome of A ...
-
bioRxiv - Bioengineering 2024Quote: ... 12 kPa (5% 40 kDa 8-arm PEG-NB, Creative PEGworks; 2 mM RGD, Genscript), and 35 kPa (7% 20 kDa 8-arm PEG-NB ...
-
bioRxiv - Immunology 2021Quote: Vaccine-elicited anti-SARS-CoV-2 antibody responses were quantified using the GenScript SARS-CoV-2 Neutralization sVNT cPASS TM Kit (GenScript Catalog #L00847-5), which effectively measures the ability of patient plasma to block the interaction between the receptor binding domain (RBD ...
-
bioRxiv - Cancer Biology 2024Quote: ... Control (#2) and p53 gRNA (#4) vectors targeting human TP53 (GenScript, pLentiCRISPR v2, Piscataway, NJ, USA) were used to homozygously delete the TP53 gene in H1975 cells as per manufacturer instructions.
-
bioRxiv - Biochemistry 2023Quote: ... A backbone vector containing the 3’ and 5’ segments of the Kv1.2 gene (including the UTR regions) in pUC57-Kan was ordered from Genscript. The final constructs were assembled using golden-gate cloning(52) ...
-
bioRxiv - Biochemistry 2022Quote: ... middle and bottom of the gradient were collected and 15 μL of each were mixed with 4 μL 4x loading buffer and heated for 3 mins before SDS-PAGE gel electrophoresis (SurePAGE 10% Bis-Tris, GenScript).
-
bioRxiv - Immunology 2023Quote: ... The synthesis of cDNA encoding SARS-CoV-2 variant Omicron BA.5 was performed by GenScript, Nanjing ...
-
bioRxiv - Immunology 2023Quote: ... The supernatant was then incubated with 2-5 ml of FLAG Affinity resin (GenScript, Nanjing, China) for 1 h at 4°C ...
-
bioRxiv - Immunology 2024Quote: ... Mice were immunized with SARS-CoV-2 Spike protein (5 µg, Val16-Pro1213, wild type, Genscript) with Alhydrogel® adjuvant 2% (InvivoGen ...
-
bioRxiv - Immunology 2022Quote: ... and 1-3 x 105 cells were stimulated for 24-48 hours with 11 SARS-CoV-2 Spike peptide pools (17- or 18-mers with 11 amino acid overlap) (Genscript, Piscataway, NJ) at a concentration of 1μg/mL per peptide ...
-
bioRxiv - Molecular Biology 2021Quote: ... plasmid (Addgene plasmid #48138)62 containing a guide RNA (5’-ACTGAGCTTGGATGCTTCTG-3’) and a donor plasmid containing 700 bp homology arms and a RPAC1 tag synthesised by GenScript into pUC57-Mini plasmid ...
-
bioRxiv - Biochemistry 2024Quote: ... 500 bp upstream and downstream of the coxM C-terminus were fused to a twin-Strep II tag (5’GGCGGTTCGGGCTGGTCCCACCCCCAGTTCGAAAAGGGTGGGGGCTCCGGTGGCGGGTCGGGTGGGTCC GCCTGGTCGCACCCGCAGTTCGAGAAG 3’) in a 1111 bp fragment synthesised by Genscript. Two ∼500bp fragments upstream and downstream of the coxG gene were fused to create a deletion construct of 1011 bp and synthesised by Genscript ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The resulting chimeric DNA sequence was flanked a 3’-BamHI and 5’-EcoRI sites and commercially synthesised (GenScript, Rijswijk, Netherlands) into vector pUC19 (pJGUC01) ...
-
bioRxiv - Microbiology 2022Quote: ... This codon-optimized version of dcas9 (Bbdcas9) was synthesized and cloned in pBluescript II KS (+) with flanking 5’ NdeI and 3’ NotI restriction endonuclease sites (GenScript), yielding pBS-Bbdcas9 ...
-
bioRxiv - Biochemistry 2024Quote: ... 3’ BamHI) SARS-Cov-2 N gene (Gene ID: 43740575) in pET-11a vector without any affinity tag (GenScript). pET-11a expression vector carrying SARS-Cov-2 N gene was transformed in BL21 (DE3 ...
-
bioRxiv - Immunology 2022Quote: ... binding of SARS-CoV2 and control IgG antibodies (at 1 µg/ml) to 15-mer S2 overlapping 5-amino acid peptides (n=52, GenScript Biotech, 500 ng/well) was tested using the same procedure as previously described (Wardemann ...
-
bioRxiv - Immunology 2022Quote: 15-mer peptides overlapping by 10 amino acids spanning the entire protein sequence of SARS-CoV-2 Spike were synthesized (GenScript; see Table S1). To stimulate whole blood or PBMC ...
-
bioRxiv - Genomics 2024Quote: ... 5% glycerol and 0.2% NP-40) and eluted with 2 mg/mL HA peptides (GenScript, no. RP11735). To prepare western blot sample from co-IP eluates ...
-
bioRxiv - Immunology 2024Quote: ... vaccines consisted of 5 µg SARS-CoV-2 Spike RBD WH-01 (RBD) protein (GenScript, cat# Z03483) or 5 µg ovalbumin (OVA ...
-
bioRxiv - Cancer Biology 2022Quote: ... and a portion was taken for replating (2×10^4 cells per replicate) with human (GenScript Z03034-50) or mouse (GenScript Z02767-10 ...
-
bioRxiv - Biochemistry 2023Quote: A 27 amino acid peptide containing amino acids 340-366 of RAD18 was purchased from GenScript and used at 200 µM for ITC binding experiments ...
-
bioRxiv - Cancer Biology 2023Quote: ... with an empty vector (PC) or a vector against Bach1 with the following gRNA 5’ GCGGTTCCGAGCCCACCGCT 3’ (GenScript Biotech Corporation, USA) (BACH1 KO ...
-
bioRxiv - Immunology 2024Quote: Total IgG was from 3 mL human serum from a patient vaccinated against SARS-CoV-2 using protein G agarose resin (Genscript). Protein G resin was washed with PBS and eluted with 0.1M glycine buffer ...
-
bioRxiv - Bioengineering 2024Quote: ... Modified synthetic sgRNAs (2’-O-methyl-3’phosphorothioate linkage modifications in the first and last three nucleotides) were purchased from Genscript. sgRNA concentration was calculated using the full-length product reporting method ...
-
bioRxiv - Immunology 2021Quote: ... All other peptides were 13 amino acids overlapping by 11 amino acids and were synthesized by GenScript. The peptides covering the envelope (E) ...
-
bioRxiv - Biophysics 2021Quote: ... Samples were incubated for 5 minutes at 95 °C and run on a 4-20% gradient SDS-PAGE gel (Genscript).
-
bioRxiv - Biochemistry 2024Quote: ... The reaction was stopped at different time points by adding Laemmli sample buffer and incubating the samples 5 min at 95 °C before loading them on Bis-Tris-SDS 4-20% polyacrylamide gels (SurePAGE, GenScript).
-
bioRxiv - Neuroscience 2024Quote: ... denatured for 5 min at 95°C and electrophoresed on a 4-12% Bis-Tris Sure PAGE (GenScript, Piscataway, NJ) with the molecular weight marker (Prime-Step Prestained ...
-
bioRxiv - Microbiology 2021Quote: ... pH 7.5) containing 3 % (w/v) skim milk powder and incubated with a rabbit anti-SLPMh 133-147 primary antibody (GenScript, Leiden, Netherlands), diluted 1:200 in TBS (10 mM TRIS ...
-
bioRxiv - Cell Biology 2023Quote: ... Additional 5’ (GCTAGCA) and ‘3 sequences (CTTAAG) were added to the cDNA to carry out the cloning procedure (GenScript, Piscataway, NJ, USA). The inactive UGGT1 D1454A variant was generated with direct mutagenesis by GenScript ...
-
Targeted Perturb-seq Reveals EGR1 and FOS as Key Regulators of the Transcriptional RAF-MAPK ResponsebioRxiv - Systems Biology 2024Quote: ... sgRNA template sequences of the format: 5′-GGAGAACCACCTTGTTGG-(N)20-GTTTAAGAGCTAAGCTGGAAAC-3′ were synthesized in a pooled format on microarray surfaces (GenScript Biotech, Inc.). Oligo pools were PCR-amplified using Phusion Flash High-Fidelity PCR Master Mix (ThermoFisher Scientific ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we constructed HDR plasmids with the egfp-chimeric hiphop-PBacDsRed cassette flanked with one kilobase homology arms 5’ and 3’ of their respective guide RNAs into pUC57-Kan (GenScript, Piscataway, NJ). The cassette consists of the 3xP3-DsRed visible marker (66 ...
-
bioRxiv - Molecular Biology 2020Quote: ... AGO1/2 and AGO1/2/3 knockout cell lines used for RNAseq were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and AGO1/2/3 knockout cell lines used for RNAseq were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...
-
bioRxiv - Biochemistry 2021Quote: ... followed by removal of trifluoroacetic acid (Genscript). When 100 μM of (PR)12 peptide and 0.5 mg/ml of poly-rA RNA were mixed ...
-
bioRxiv - Microbiology 2021Quote: ... Specific anti-CoV immunoreactivity was detected using an in-house SARS-CoV-2 nucleocapsid protein (U864YFA140-4/CB2093) rabbit antibody (Genscript) at a 1:1000 dilution ...
-
bioRxiv - Biochemistry 2021Quote: ... To elute the OST complex the beads were incubated for 2 hrs at 4 °C with purification buffer enriched with 0.5 mg/mL 1D4 peptide (GenScript Corp.). The flow-through was collected in a 100 kDa cutoff filter column (Amicon Centrifugal Filter Device) ...
-
bioRxiv - Cancer Biology 2024Quote: Gene blocks containing three fragments of the long isoform of NAB2-STAT6 (exons 1-4 of NAB2 and exons 2-22 of STAT6) with a c-terminal FLAG tag were ordered from GenScript. Using Gibson Assembly® Master Mix (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... Peptide cleavage reporter assays were prepared by combining 1 µL of PsCaspase cell lysates with 2 µL of 100 µM synthetic 7-amino-4-methylcoumarin (AMC)-conjugated peptides (Genscript) and 5 µL of 100 mM sodium phosphate buffer (pH 7.4 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Plates were coated ON at 4 °C with 2 µg/mL mouse anti-human IgG Fc (Genscript, Piscataway, NJ, USA) in PBS ...
-
bioRxiv - Microbiology 2024Quote: ... followed by staining of cells with primary rabbit anti-SARS-CoV-2 N Wuhan-1 antibody (Genscript U739BGB150-5) (1:2000 dilution ...
-
bioRxiv - Developmental Biology 2023Quote: ... were also commercially synthesized with 5’EcoRV and 3’SpeI ends and cloned into the pCDNA3.1 vector by Genscript (Genscript USA, Piscataway, NJ). To construct the inducible GR-RFX6 wild type or mutants used in cycloheximide direct target assays ...
-
bioRxiv - Biochemistry 2021Quote: BiP-binding sites 1 and 3 were synthesized by Alan Scientific (Gaithersburg, MD) and site 2 was synthesized by Genscript (Piscataway, NJ). All peptides are N-terminally labeled with FITC via an amino hexanoic acid linker ...
-
bioRxiv - Cancer Biology 2021Quote: ... The lysate was heated at 95°C for 5 min and centrifuged at 10000 rpm/s for 2 min to remove the insoluble material prior to SDS-PAGE in a 4-20% gradient ExpressPlus™ PAGE Gels (Genscript) at constant 120 V for 1 h ...
-
bioRxiv - Microbiology 2020Quote: ... were coated overnight at 4°C with 2μg/ml of recombinant SARS-CoV-2 S1-RBD protein (GenScript No. Z03483-1) in carbonate-bicarbonate buffer (Sigma Aldrich No ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 million cells/well were added into a 6-well plate and cultured with 2 mL RPMI-1640 medium/well (10 ng/mL IL-4, and 20 ng/mL mGM-CSF, GenScript, China) to obtain BMDCs at 37°C with 5% CO2 ...
-
CRISPR-based environmental biosurveillance assisted via artificial intelligence design of guide-RNAsbioRxiv - Molecular Biology 2024Quote: ... 4 µL of 5X optimized Cas13a reaction buffer (see Supplemental Table 6) or 2 µL 10X Cas13a reaction buffer (GenScript, #Z03486), 0.5 µL of Murine RNAse inhibitor (New England Biolabs - NEB ...
-
bioRxiv - Biochemistry 2021Quote: ... Peptide-pulsing of target cells was performed by incubating EBV-LCLs in FBS-free medium at a density of 5×106 cells/ml for 2 hours in the presence of individual peptides (107 pg/ml, Genscript). After an overnight incubation ...
-
bioRxiv - Biochemistry 2021Quote: ... ATAD1 was diluted in 2-fold dilution series and incubated with 100 nM fluorescently-labeled peptide (P13: 5-FAM-FSRLYQLRIR, purchased from Genscript) for 20 minutes at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... and Omicron BA.5 spike were based on the codon-optimised spike sequence of SARS-CoV-2 and were generated by GenScript Inc ...