Labshake search
Citations for GenScript :
51 - 100 of 1109 citations for 2 Chloro 1 1 trifluoromethyl 1 3 4 9 tetrahydro 2H beta carbolin 2 yl ethan 1 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... followed by staining of cells with primary rabbit anti-SARS-CoV-2 N Wuhan-1 antibody (Genscript U739BGB150-5) (1:2000 dilution ...
-
bioRxiv - Biophysics 2024Quote: Gene sequences for nsp7-11 and Mpro used were taken from “Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1” as published in January 2020 (replaced by NCBI LOCUS NC_045512) and commercially synthesized (GenScript). The synthetic gene sequence for nsp7-11C and nsp7-11N with suitable overhangs were cloned with Type IIS restriction enzymes into either pASK35+ and pASK33+ (IBA life sciences) ...
-
bioRxiv - Immunology 2022Quote: Human codon-optimized sequences of the ectodomain of SARS-CoV-2 spike protein (Wuhan Hu-1 complete genome, GenBank: MN908947.1) was synthesized by GenScript, Piscataway ...
-
bioRxiv - Immunology 2024Quote: Antibodies were then purified using 1- to 2-mL of protein A or G resin (Genscript L00210 and L00209) with gravity columns (Bio-Rad 7321010) ...
-
bioRxiv - Bioengineering 2024Quote: ... or 4 μg BMP-2 (Genscript, Piscataway, NJ) per mg GMs ...
-
bioRxiv - Biochemistry 2022Quote: The genes of the human AC isoforms 1 – 9 cloned into the expression plasmid pcDNA3.1+/C-(K)-DYK were purchased from GenScript and contained a C-terminal flag-tag ...
-
bioRxiv - Plant Biology 2020Quote: ... three separated segments (excluding the TCP domain) from the COM1 gene each containing 300-360 bp were synthesized (probe 1 and 2, GenScript Biotech ...
-
bioRxiv - Biophysics 2020Quote: ... Recombinant nucleocapsid protein of SARS-CoV-2 (Catalog No: Z03488- 1) and SRPK1 kinase (Catalog No: PV4215) were purchased from GenScript andThermoFisher ...
-
bioRxiv - Immunology 2022Quote: ... human codon-optimized cDNA encoding SARS-CoV-2 spike glycoprotein of the WA-1/2020 and variants were synthesized by GenScript and cloned into eukaryotic cell expression vector pcDNA 3.1 between the BamHI and XhoI sites ...
-
bioRxiv - Immunology 2021Quote: ... were coated with 100 µL of SARS-CoV-2 RBD (1 µg/mL) (cat n° Z03479, GenScript, Piscataway, NJ, USA) and S1 subunit (0.5 µg/mL ...
-
Activation of endoplasmic reticulum stress via clustering of the inner nuclear membrane protein SUN2bioRxiv - Cell Biology 2022Quote: ... and SUN2-N-2 (AA 1-226) fragments by PCR from pcDNA3.1+/C-(K)DY-SUN2 vector (OHu01874,GenScript # NM_001199579.1) and subsequent cloning into MP029-CRY2-mCherry lentiviral vector using the NheI/XbaI restriction sites ...
-
bioRxiv - Immunology 2022Quote: ... for 30 minutes before adding 100 ng/mL of Sars-CoV-2 spike protein (RBD, HisTag) (Cat. ZO3483-1-GenScript) or infected using Heat-inactivated SARS-CoV-2 (VR-1986HK ...
-
bioRxiv - Cell Biology 2020Quote: ... Ctdnep1-GFP and Ctdnep1 _D67E-GFP siRNA resistant sequences adding silent mutations for Ctdnep1 siRNAs #1 and #2 were synthesized (GenScript) and cloned directly to pcDNA3.1(+)-C-eGFP vector.
-
bioRxiv - Microbiology 2020Quote: The SARS-CoV-2 S gene from the Wuhan-Hu-1 isolate (GenBank: MN908947.3) was codon optimized (Genscript, Township, NJ) and cloned in pMD2iPuror in EcoRI/XhoI ...
-
bioRxiv - Microbiology 2022Quote: ... pcDNA3.1 encoding CoV-2 Omicron (BA.1) Spike tagged with a His epitope on the N-terminus was synthesized provided by Genscript. pMD2.G encoding VSV-G (12259 ...
-
bioRxiv - Immunology 2022Quote: ... for 30 minutes before being exposed with 100 ng/mL of Sars-CoV-2 spike protein (RBD, HisTag) (Cat. ZO3483-1-GenScript) at different times (5 ...
-
bioRxiv - Microbiology 2022Quote: ... was assembled from a PCR performed on a codon-optimized SARS-CoV-2 Omicron BA.1 sequence synthesized by Genscript. Fragments were assembled with a PCR fragment containing the fpl and mNG2(11 ...
-
bioRxiv - Microbiology 2022Quote: ... were stimulated for 24 h with 15-mer overlapping peptides from SARS-CoV-2 spike glycoprotein (Cat no# PM-WCPV-S-1, JPT Peptide Technologies GmbH) or VSV-N (Genscript) at a concentration of 2.5 µg/mL ...
-
bioRxiv - Molecular Biology 2024Quote: ... Slot-RL and the recoded versions of pEGFP (pEGFP-1, EGFP-2), pRL (pRL1, pRL2 and pRL3) and N (p5’L-N1, pN1) were obtained from GenScript.
-
bioRxiv - Microbiology 2021Quote: ... anti-SpoVAD64 (1:10,000) and anti-His (1:4,000) (GenScript) antibodies ...
-
bioRxiv - Developmental Biology 2020Quote: ... Dkk-1 (GenScript) was added to BM at final concentration of 100 ng/ml ...
-
bioRxiv - Neuroscience 2024Quote: ... FAT-1 (Genscript), and FAT-2 (Genscript ...
-
bioRxiv - Microbiology 2024Quote: ... 1 (Genscript Biotech). Additionally ...
-
bioRxiv - Immunology 2021Quote: ... and beta (1-244) chains were synthesized and cloned into the bacterial expression vector pET30a via NdeI and XhoI (Genscript, USA). Proteins were expressed as inclusion bodies in BL21 (DE3 ...
-
bioRxiv - Genomics 2021Quote: ... Ada2b (rabbit polyclonal, 1:1000; GenScript anti-amino-acid 1-330); anti-Flag-horseradish peroxidase (mouse ...
-
Development of monoclonal antibody-based blocking ELISA for detecting SARS-CoV-2 exposure in animalsbioRxiv - Microbiology 2023Quote: ... The SARS-CoV-2 full-length N gene of Wuhan-hu-1 isolate (GenBank # NC 045512.2) was synthesized (GenScript, Piscataway, NJ) and cloned in the pET-28a (+ ...
-
bioRxiv - Molecular Biology 2022Quote: ... VHL 3KR-14-3-3ζ (1-230) 19KR K49E mutation were synthesized by GenScript Biotech ...
-
bioRxiv - Biochemistry 2024Quote: ... non-targeting sgRNA (TGCTTTACCGCGTTGGGTAA) or CLYBL targeting sgRNA (exon 2: CATAGAGCACTGCTCTCCGG; exon 3: AGACTTTGACCTGGGCACAA; exon 4: CCATTGCAGTCTCCACAAAG) were purchased from Genscript. Plasmids were transformed into OneShot™ E ...
-
bioRxiv - Neuroscience 2021Quote: ... plko.1-CMV.Puro-tGFP-shFoxg1 or plko.1-CMV.Puro-tGFP-shLuciferase (Genscript) plasmids ...
-
bioRxiv - Plant Biology 2024Quote: WT or mutated lysine 4 trimethylated H3 (1-20aa) peptides were synthesized by GenScript Biotech Corporation ...
-
bioRxiv - Biochemistry 2022Quote: ... or by adding 200 ng/well of monovalent or bivalent cAbCMY-2 (254) recognized by 1/2000 diluted rabbit anti-HCAbs antibody conjugated to HRP (Genscript, United States). TMB was used as substrate while reaction was stopped by 1 M H3PO4 ...
-
bioRxiv - Microbiology 2022Quote: ... Fifteen-mer overlapping peptides from SARS-CoV-2 spike glycoprotein (Cat# PM-WCPV-S-1, JPT peptides, Berlin, Germany) and MeV-nucleoprotein (Genscript, NJ, USA) were used to stimulate splenocytes at 5 µg/mL ...
-
bioRxiv - Cell Biology 2021Quote: ... 1:100 (A00487, Genscript). All secondary antibodies were purchased from Invitrogen and used at 1:700 and were Alexa Fluor-488 Donkey anti-rabbit (A21206) ...
-
bioRxiv - Immunology 2022Quote: ... β-Actin (GenScript, 1:15,000), T-bet (clone 4B10 Santa Cruz ...
-
bioRxiv - Immunology 2022Quote: ... β-actin (GenScript, 1:15,000), goat anti-mouse (Jackson Immunoresearch ...
-
bioRxiv - Biophysics 2024Quote: ... named EKAR-1 (GenScript). To create entry vectors ...
-
β-amyloid−driven synaptic depression requires PDZ protein interaction at AMPA-receptor subunit GluA3bioRxiv - Neuroscience 2021Quote: ... The following antibodies were used: anti-GluA2/3 (1:2000; CQNFATYKEGYNVYGIESVKI, custom made at Genscript) (Chen et al. ...
-
bioRxiv - Biophysics 2024Quote: ... coli and cloned into the 5’BamHI and 3’XhoI sites of pGEX6P-1 (GenScript).
-
bioRxiv - Biochemistry 2020Quote: ... 1-932 and EAV nsp9 1-693 was synthesized with codon optimization (Genscript) and cloned into pFastBac with an N-terminal MG addition and C-terminal TEV protease site and two Strep tags ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Microbiology 2024Quote: ... The 2-mer and 3-mer oligos were ordered from GenScript USA ...
-
bioRxiv - Pathology 2022Quote: ... bat sera were screened at a 1:10 dilution using a competitive enzyme linked immunosorbent assay (SARS-CoV-2 sVNT, GenScript, Piscataway, New Jersey) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... SARS-CoV-2 nsp5 was cloned into the pGEX-6P-1 vector using BamHI and XhoI and then synthesized commercially (GenScript, Piscataway, NJ, USA). A native N-terminus is attained during expression through an nsp5 autoprocessing site corresponding to the cleavage between nsp4 and nsp5 in the viral polyprotein ...
-
bioRxiv - Immunology 2023Quote: ... Sera were screened at a 1:10 dilution using a competitive enzyme linked immunosorbent assay with the S-RBD horseradish peroxidase (HRP) for Omicron BA.1 (SARS-CoV-2 sVNT L00847-A and S-RBD HRP Z03730, GenScript, Rijswijk, The Netherlands) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... accession number XM_006514830.3) and type 3 (transcript variant 1, accession number NM_001363282.1) was purchased from GenScript (Clone IDs OMu45282 and OMu45285 ...
-
bioRxiv - Microbiology 2024Quote: ... Western blot membranes were probed with primary antibody (either 1:4000 rabbit anti-FLAG [Sigma Aldrich, St. Louis MO] or 1:4000 or 1:2000 mouse anti-StrepII [Genscript, Piscataway NJ]) for 1 hour at room temperature or overnight at 4°C and with secondary antibody (either 1:5000 goat anti-rabbit or anti-mouse respectively conjugated to horseradish peroxidase (HRP ...
-
bioRxiv - Developmental Biology 2024Quote: ... Rabbit polyclonal anti-IFET-1 and anti-CAR-1 antibodies were made by GenScript.
-
bioRxiv - Microbiology 2022Quote: ... α-CrPV-VP2 (1:1000, Genscript), α-CrPV-3C (1:1000 ...
-
bioRxiv - Immunology 2021Quote: ... S1 (GenScript, Cat # Z03485-1) and RBD (aa 319-591 ...
-
bioRxiv - Cell Biology 2020Quote: ... FLAG (A00187, GenScript (1:1,000)) ...