Labshake search
Citations for GenScript :
51 - 100 of 1023 citations for 1 5 Bromo 1 2 Trimethylsilyl Ethoxy Methyl 1H Pyrrolo 2 3 B Pyridin 3 Yl Ethanone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2021Quote: ... PC-1 and PC-2 coiled-coil domain peptides were custom-made (Genscript). PC-1 or PC-2 peptides were added to pipette solution immediately before use at a final concentration of 1 μM ...
-
bioRxiv - Microbiology 2022Quote: The SARS-CoV-2 Wuhan-Hu-1 RBD construct was synthesized by GenScript into pcDNA3.1-with an N-terminal mu-phosphatase signal peptide and a C-terminal octa-histidine tag ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µL of competence specific peptide (1 mg/mL, DLRGVPNPWGWIFGR, synthetized by GenScript) and 1-5 µL of linear double-stranded DNA PCR product were mixed in a microcentrifuge tube ...
-
bioRxiv - Molecular Biology 2020Quote: ... The selected sgRNA with additional 20 bp RP-loop [5’TCTCCCTGAGCTTCAGGGAG-3’] at the 5’ end of guide RNA was custom synthesized by Genscript, cloned into plasmid pUC57 with unique restriction sites (Pcil ...
-
bioRxiv - Immunology 2023Quote: Lentiviral vectors for expression of SARS-CoV-2 spike (Delta variant B.1.617.2, NCBI accession # OX014251.1) were designed and synthesized from Genscript together with the two packaging plasmids (pMD2.G and psPAX2) ...
-
bioRxiv - Molecular Biology 2024Quote: ... mouse anti-Strep-tag (IBA, 2-1507-001, 1:1,000) rabbit anti-CBP-tag (GenScript, A00635-40, 1:1,000), mouse anti-V5-tag (Proteintech Group ...
-
bioRxiv - Molecular Biology 2022Quote: ... Sangon Biotech) and RNA (5’-Cy5-ACGCGUCGCAGGCCU UUUUAUU-3’; 0.3 mM, final concentration; GenScript Biotech Corp.) in 50 μL annealing buffer (5 mM Tris-HCl ...
-
bioRxiv - Immunology 2020Quote: The SARS-CoV-2 pseudovirus was produced by co-transfection of HEK293T cells with 1:1 ratio of DNA plasmid encoding SARS-CoV-2 S protein (GenScript) and backbone plasmid pNL4-3.Luc.R-E-(NIH AIDS Reagent ...
-
bioRxiv - Immunology 2023Quote: Genes coding for SARS-CoV-2 Spike (S) ectodomains (Hu-1 and BA.1) with Hisx8 and Strep tags were synthesized by Genscript and cloned into the pcDNA3.1(+ ...
-
bioRxiv - Biochemistry 2024Quote: The sequence encoding the NSP3 ubiquitin-like domain 1 (Ubl1, residues 1-110) of SARS-CoV-2 was synthesized by Genscript Biotech and inserted into the pCMV-3Tag-3A plasmid ...
-
bioRxiv - Immunology 2022Quote: ... A total of 500,000 splenocytes were restimulated ex vivo with the full-length SARS-CoV-2 B.1.1.529 S 15-mer (overlapping by 11 amino acids) peptide pool (GenScript) in plates pre-coated with anti-IFN-γ or anti-IL-4 antibodies ...
-
bioRxiv - Genetics 2024Quote: ... and bam 3’UTR by Genscript, Inc (Piscataway ...
-
bioRxiv - Immunology 2021Quote: Vaccine-elicited anti-SARS-CoV-2 antibody responses were quantified using the GenScript SARS-CoV-2 Neutralization sVNT cPASS TM Kit (GenScript Catalog #L00847-5), which effectively measures the ability of patient plasma to block the interaction between the receptor binding domain (RBD ...
-
bioRxiv - Bioengineering 2021Quote: Purified RfxCas13d proteins and synthetic crRNAs were mixed (unless otherwise indicated) at 2:1 molar ratio in Buffer 1 (GenScript SC1841) or Buffer 22 (25mM Tris pH 7.5 ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were then incubated overnight at 4 °C with primary antibodies at 1:100 dilution in PBST and 1 % BSA [SARS-COV-2 Spike S1 antibody (#HC2001 GenScript - #A02038), p62 antibody (#BD 610832) ...
-
bioRxiv - Microbiology 2021Quote: ... the membrane was incubated with 1:7000 polyclonal anti-Bma-LAD-2 peptide antibodies (Genscript) and 1:1000 rabbit anti-β actin antibodies (Abcam ...
-
bioRxiv - Immunology 2021Quote: ... were coated with 100 µL of SARS-CoV-2 RBD (1 µg/mL) (GenScript, USA) in carbonate bicarbonate buffer (pH 9.6 ...
-
bioRxiv - Microbiology 2020Quote: Human EnvP(b)1 codon-optimized sequence was ordered from GenScript. EnvP(b)1 sequences from chimpanzee ...
-
bioRxiv - Microbiology 2021Quote: ... Wildtype 3’UTR and 3’UTR coding sequences containing all 16 editing mutations were synthesized commercially (Genscript). Forward primers were designed to add the T7 promoter gactcgtaatacgactcactataggggaagag at the 5’ end ...
-
bioRxiv - Cell Biology 2023Quote: ... The 14-3-3 permanent bind forms of Hdac4 fragments of Hdac4-3R18 were synthesized by Genscript. The shRNA lentivirus vector for 14-3-3 isoforms ...
-
bioRxiv - Neuroscience 2024Quote: ... Tween20) for 1h and probed with the following primary antibodies: rabbit anti-DYKDDDDK-tag (1:2000, GenScript, #A00170) and mouse anti-actin (1:1000 ...
-
bioRxiv - Microbiology 2024Quote: ... The following gRNA sequence targeting ATF3 was cloned into pLentiCRISPRv2 plasmid: 5’-CCACCGGATGTCCTCTGCGC-3’ (Genscript, Clone ID C88007). HEK 293FT cells were co-transfected with pLentiCRISPRv2-ATF3 CRISPR gRNA ...
-
bioRxiv - Biochemistry 2022Quote: ... Wells were washed 3 times in PBS and incubated with 1:1000 anti-His HRP antibody (GenScript, A00612, Lot. 19K001984) for 1 hour at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... DNA encoding 2DS1 (3-200) and 2DS4 (3-200) were synthesized and cloned into pET28c by Genscript (USA). Plasmid encoding 2DL1 (1-224 ...
-
bioRxiv - Biochemistry 2023Quote: ... and at the 3’ end with 293 bp actin 3’ UTR followed by 500 bp of Tb927.7.6110 3’ UTR was synthesized by Genscript. The same construct containing a blasticidin-S deaminase (BSD ...
-
bioRxiv - Immunology 2021Quote: ... chimeric group 1 or group 2 stalk proteins expressed in Sf9 cells were column purified (GenScript). For functional assays and luminex Fc receptor binding and titer ...
-
bioRxiv - Cell Biology 2023Quote: ... rabbit anti-Akr1B-2 at 1:100,000 (produced to full-length Drosophila p23 (Q9VH95) by GenScript) and mouse anti-α-Tubulin at 1:5000 (AB_477593 ...
-
bioRxiv - Biochemistry 2023Quote: ... A backbone vector containing the 3’ and 5’ segments of the Kv1.2 gene (including the UTR regions) in pUC57-Kan was ordered from Genscript. The final constructs were assembled using golden-gate cloning(52) ...
-
bioRxiv - Bioengineering 2024Quote: ... 12 kPa (5% 40 kDa 8-arm PEG-NB, Creative PEGworks; 2 mM RGD, Genscript), and 35 kPa (7% 20 kDa 8-arm PEG-NB ...
-
bioRxiv - Microbiology 2021Quote: ... N501Y.V1 (Variant 1) mutant Spike proteins of SARS-CoV-2 were codon-optimized and synthesized by GenScript Inc (Nanjing ...
-
bioRxiv - Biochemistry 2024Quote: ... The column was washed with 15 mL TBS and eluted with 3 mL of 150 µg/mL 3×FLAG peptide (Genscript) in TBS ...
-
bioRxiv - Immunology 2022Quote: ... 3) TCRα-CD3δ crosslinking: mouse anti-cMyc (Genscript) and rabbit anti-FLAG (Genscript) ...
-
bioRxiv - Bioengineering 2024Quote: ... and 3 U/mL erythropoietin (all from Genscript). Cultures were allowed to continue for an additional 2 weeks and then imaged and scored again ...
-
bioRxiv - Molecular Biology 2023Quote: ... radiodurans (Supplementary Table 3) were synthesized by GenScript, along mini-Tn elements containing a chloramphenicol resistance gene ...
-
bioRxiv - Microbiology 2023Quote: ... A total of 5 peptides matching inoculum sequences for both the WT and SS14-DCKO strains (Table 3, labelled with a superscripted “1”) were produced by Genscript (Piscataway, NJ). Upon reception ...
-
bioRxiv - Genetics 2023Quote: ... every 1 μg RNA solution was ligated with 3 μl 25-μM poly(A)-ssRNA adaptor (pAGCUAAAAAAAAAAAAp, synthesized by GenScript Biotech Co.) at 16 °C overnight ...
-
bioRxiv - Microbiology 2024Quote: ... V165A & R166A)50 and NL4.3(Δ: Δ(105 − 278)&Δ(301 − 332))44 in the HIV-1 proviral clone pNL4-3 were performed by GenScript. For use in electron microscopy ...
-
bioRxiv - Molecular Biology 2021Quote: ... plasmid (Addgene plasmid #48138)62 containing a guide RNA (5’-ACTGAGCTTGGATGCTTCTG-3’) and a donor plasmid containing 700 bp homology arms and a RPAC1 tag synthesised by GenScript into pUC57-Mini plasmid ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The resulting chimeric DNA sequence was flanked a 3’-BamHI and 5’-EcoRI sites and commercially synthesised (GenScript, Rijswijk, Netherlands) into vector pUC19 (pJGUC01) ...
-
bioRxiv - Microbiology 2022Quote: ... This codon-optimized version of dcas9 (Bbdcas9) was synthesized and cloned in pBluescript II KS (+) with flanking 5’ NdeI and 3’ NotI restriction endonuclease sites (GenScript), yielding pBS-Bbdcas9 ...
-
bioRxiv - Biochemistry 2024Quote: ... 500 bp upstream and downstream of the coxM C-terminus were fused to a twin-Strep II tag (5’GGCGGTTCGGGCTGGTCCCACCCCCAGTTCGAAAAGGGTGGGGGCTCCGGTGGCGGGTCGGGTGGGTCC GCCTGGTCGCACCCGCAGTTCGAGAAG 3’) in a 1111 bp fragment synthesised by Genscript. Two ∼500bp fragments upstream and downstream of the coxG gene were fused to create a deletion construct of 1011 bp and synthesised by Genscript ...
-
bioRxiv - Molecular Biology 2024Quote: ... or LV1-eGFP-miR-7 were generated by subcloning inserts from pAAV_hSYN1-eGFP-miR-7 and pAAV_hSYN1-eGFP (provided by Thomas B. Hansen) inside LV1 (immunodeficiency virus 1 (HIV-1)-based LV-PGK-GFP) backbone by GenScript Biotech Corporation ...
-
bioRxiv - Developmental Biology 2021Quote: ... The loaf sgRNA sequences GCTGGTGATTACGTCGGTGA (loaf gRNA 1) and TGCGGGACCATCCGGGTACC (loaf gRNA 2) identified on www.flyrnai.org/crispr2 were made with gene synthesis in pUC57 (GenScript) and cloned into pCFD4 (Port et al ...
-
bioRxiv - Immunology 2023Quote: ... 50 μl of phycoerythrin (PE)– conjugated human angiotensin-converting enzyme 2 (ACE2) (hACE2; 1 μg per milliliter; GenScript) was added to the well and incubated for 30 minutes at 37°C with agitation ...
-
bioRxiv - Neuroscience 2024Quote: ... and FAT-2 (Genscript) cDNAs were amplified with PCR and subcloned into the pHR-hSyn-EGFP vector (Addgene #114215 ...
-
bioRxiv - Immunology 2023Quote: ... The supernatant was then incubated with 2-5 ml of FLAG Affinity resin (GenScript, Nanjing, China) for 1 h at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... The synthesis of cDNA encoding SARS-CoV-2 variant Omicron BA.5 was performed by GenScript, Nanjing ...
-
bioRxiv - Immunology 2024Quote: ... Mice were immunized with SARS-CoV-2 Spike protein (5 µg, Val16-Pro1213, wild type, Genscript) with Alhydrogel® adjuvant 2% (InvivoGen ...
-
bioRxiv - Biophysics 2024Quote: ... nucleotide sequence 5’ GCA GTG CTC CAA AGC GGA TTT CGC 3’) of mSca-containing DuProSense with PLpro cleavage sites (Supporting Table 3) (GenScript Biotech (Singapore) Pte ...
-
bioRxiv - Biophysics 2024Quote: ... nucleotide sequence 5’ CTG AAA GGC GGC GCG CCG ACC AAA 3’) of mSca-containing DuProSense with Mpro cleavage sites (Supporting Table 3) (GenScript Biotech (Singapore) Pte ...