Labshake search
Citations for GenScript :
51 - 100 of 836 citations for 1 1 Benzofuran 2 yl 1 phenylmethanamine hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... 1 mM RGD peptide (GenScript) was added to the precursor solution ...
-
bioRxiv - Biochemistry 2023Quote: ... Strep (Genscript A01732, 1: 5,000), c-myc (Invitrogen 13-2500 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The loaf sgRNA sequences GCTGGTGATTACGTCGGTGA (loaf gRNA 1) and TGCGGGACCATCCGGGTACC (loaf gRNA 2) identified on www.flyrnai.org/crispr2 were made with gene synthesis in pUC57 (GenScript) and cloned into pCFD4 (Port et al ...
-
bioRxiv - Immunology 2023Quote: ... 50 μl of phycoerythrin (PE)– conjugated human angiotensin-converting enzyme 2 (ACE2) (hACE2; 1 μg per milliliter; GenScript) was added to the well and incubated for 30 minutes at 37°C with agitation ...
-
bioRxiv - Immunology 2020Quote: ... Test serum (1:100 dilution) or the mAb 5B7D7 (1 µg/ml) (GenScript, Piscataway, NJ) was diluted in CSA buffer and incubated for 1 hour at room temperature with 0.1 µg/mL RBD-Fc (BPS Bioscience ...
-
bioRxiv - Biochemistry 2020Quote: ... Recombinant SARS-CoV-1 spike protein was obtained from SinoBiological and SARS-CoV-2 spike was obtained from Genscript and Acro Biosystems.
-
bioRxiv - Immunology 2022Quote: ... A codon-optimized version of the full-length spike gene of the Wuhan-1 SARS-CoV-2 strain (MN908947.3; GenScript) was cloned into the Monogram proprietary env expression vector ...
-
bioRxiv - Microbiology 2021Quote: ... succinimidyl ester)-LPSXG-(5-[(2-aminoethyl)amino]naphthalene-1-sulfonic acid) (Edans) peptides were provided by GenScript (Piscataway, NJ). Six peptide sequences were selected for study ...
-
bioRxiv - Plant Biology 2021Quote: ... The supernatant was collected and incubated for 1 h with 2 ml of 50% slurry of Glutathione Resin (Genscript) before loading onto an empty EconoPac gravity-flow column (Bio-Rad Laboratories ...
-
bioRxiv - Immunology 2022Quote: Human codon-optimized sequences of the ectodomain of SARS-CoV-2 spike protein (Wuhan Hu-1 complete genome, GenBank: MN908947.1) was synthesized by GenScript, Piscataway ...
-
bioRxiv - Biophysics 2024Quote: Gene sequences for nsp7-11 and Mpro used were taken from “Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1” as published in January 2020 (replaced by NCBI LOCUS NC_045512) and commercially synthesized (GenScript). The synthetic gene sequence for nsp7-11C and nsp7-11N with suitable overhangs were cloned with Type IIS restriction enzymes into either pASK35+ and pASK33+ (IBA life sciences) ...
-
bioRxiv - Microbiology 2024Quote: ... followed by staining of cells with primary rabbit anti-SARS-CoV-2 N Wuhan-1 antibody (Genscript U739BGB150-5) (1:2000 dilution ...
-
bioRxiv - Microbiology 2024Quote: The set 1 and set 2 pooled sgRNA oligos were synthesized as one oligo chip by GenScript (Nanjing, China), and the oligo sequences were listed in Supplementary Table S4 ...
-
bioRxiv - Immunology 2024Quote: Antibodies were then purified using 1- to 2-mL of protein A or G resin (Genscript L00210 and L00209) with gravity columns (Bio-Rad 7321010) ...
-
bioRxiv - Cell Biology 2022Quote: ... GRGDSPC peptide (1% w/v) (Genscript) was added to the solution ...
-
bioRxiv - Molecular Biology 2020Quote: ... anti-GFP (1:1000) (GenScript, A01704) anti-MRG-1 (1:1000 ...
-
bioRxiv - Biophysics 2020Quote: ... MEC-10 and DEGT-1 (GenScript) in the pGEM-HE oocyte expression vector (Liman et al. ...
-
bioRxiv - Microbiology 2021Quote: ... CSP-1 (GenScript, New Jersey, USA), as previously described (36) ...
-
bioRxiv - Cell Biology 2022Quote: ... or GST (1:500, Genscript A00865), followed by 1:3000 HRP-conjugated Goat anti-rabbit or Goat anti-mouse secondary antibodies (Bio Rad) ...
-
bioRxiv - Immunology 2022Quote: ... and 1 μM TPI peptide (Genscript).
-
bioRxiv - Molecular Biology 2023Quote: ... FLAG (1:1,000 (A00187, GenScript, RRID:AB_1720813)) ...
-
bioRxiv - Biophysics 2022Quote: ... and 1 μM TPI peptide (Genscript) for surface expression of TPI:HLA-DR1 ligand for the E8 TCR.35
-
bioRxiv - Developmental Biology 2022Quote: ... DUXBL (1:500, custom antibody, GenScript), HDAC1 (1:100 ...
-
bioRxiv - Developmental Biology 2024Quote: ... Mouse anti-V5 (1:10,000; Genscript), Anti-V5 tag antibody [SV5-P-K](1:5,000 ...
-
bioRxiv - Molecular Biology 2024Quote: Purified Aβ42 (Genscript, Cat# RP20527-1), was solubilized in 1% NH3 at 12.5mg/ml then diluted to 1mg/ml in PBS ...
-
bioRxiv - Biochemistry 2024Quote: Protein A resin (1 mL, GenScript) was prepared by washing with 25 mL TBS in a gravity purification column ...
-
bioRxiv - Bioengineering 2024Quote: ... additionally CRGDS peptide (1 mM, GenScript) was added for cell adhesion ...
-
bioRxiv - Biochemistry 2024Quote: ... anti-Strep (Genscript, A01732, 1:1000), goat anti-rat IgG (Thermo Scientific ...
-
bioRxiv - Biophysics 2022Quote: ... Protein was eluted by incubation with 3 BVs elution buffer (wash buffer supplemented with either 3C protease (1:10 w:w 3C:ABCA7) or 0.5 mg ml-1 1D4 peptide (GenScript)) for 2-18 hours.
-
bioRxiv - Cell Biology 2020Quote: ... 10% glycerol) with protease inhibitors and NEM containing 30 μL 1:1 anti FLAG Affinity Gel (Genscript). S100 supernatant was added directly to 600 μL of basic lysis buffer with protease inhibitors and NEM containing 30 μL 1:1 anti FLAG Affinity Gel (Genscript) ...
-
bioRxiv - Biochemistry 2024Quote: ... Clarified lysate from 1 L of culture was incubated with 1 mL of equilibrated Ni-resin (Genscript) and washed with 30 mL wash buffer (50 mM Tris pH 7.5 ...
-
bioRxiv - Plant Biology 2020Quote: ... three separated segments (excluding the TCP domain) from the COM1 gene each containing 300-360 bp were synthesized (probe 1 and 2, GenScript Biotech ...
-
bioRxiv - Biophysics 2020Quote: ... Recombinant nucleocapsid protein of SARS-CoV-2 (Catalog No: Z03488- 1) and SRPK1 kinase (Catalog No: PV4215) were purchased from GenScript andThermoFisher ...
-
bioRxiv - Immunology 2022Quote: ... human codon-optimized cDNA encoding SARS-CoV-2 spike glycoprotein of the WA-1/2020 and variants were synthesized by GenScript and cloned into eukaryotic cell expression vector pcDNA 3.1 between the BamHI and XhoI sites ...
-
bioRxiv - Immunology 2021Quote: ... were coated with 100 µL of SARS-CoV-2 RBD (1 µg/mL) (cat n° Z03479, GenScript, Piscataway, NJ, USA) and S1 subunit (0.5 µg/mL ...
-
Activation of endoplasmic reticulum stress via clustering of the inner nuclear membrane protein SUN2bioRxiv - Cell Biology 2022Quote: ... and SUN2-N-2 (AA 1-226) fragments by PCR from pcDNA3.1+/C-(K)DY-SUN2 vector (OHu01874,GenScript # NM_001199579.1) and subsequent cloning into MP029-CRY2-mCherry lentiviral vector using the NheI/XbaI restriction sites ...
-
bioRxiv - Immunology 2022Quote: ... for 30 minutes before adding 100 ng/mL of Sars-CoV-2 spike protein (RBD, HisTag) (Cat. ZO3483-1-GenScript) or infected using Heat-inactivated SARS-CoV-2 (VR-1986HK ...
-
bioRxiv - Cell Biology 2020Quote: ... Ctdnep1-GFP and Ctdnep1 _D67E-GFP siRNA resistant sequences adding silent mutations for Ctdnep1 siRNAs #1 and #2 were synthesized (GenScript) and cloned directly to pcDNA3.1(+)-C-eGFP vector.
-
bioRxiv - Microbiology 2020Quote: The SARS-CoV-2 S gene from the Wuhan-Hu-1 isolate (GenBank: MN908947.3) was codon optimized (Genscript, Township, NJ) and cloned in pMD2iPuror in EcoRI/XhoI ...
-
bioRxiv - Microbiology 2022Quote: ... were stimulated for 24 h with 15-mer overlapping peptides from SARS-CoV-2 spike glycoprotein (Cat no# PM-WCPV-S-1, JPT Peptide Technologies GmbH) or VSV-N (Genscript) at a concentration of 2.5 µg/mL ...
-
bioRxiv - Microbiology 2022Quote: ... pcDNA3.1 encoding CoV-2 Omicron (BA.1) Spike tagged with a His epitope on the N-terminus was synthesized provided by Genscript. pMD2.G encoding VSV-G (12259 ...
-
bioRxiv - Immunology 2022Quote: ... for 30 minutes before being exposed with 100 ng/mL of Sars-CoV-2 spike protein (RBD, HisTag) (Cat. ZO3483-1-GenScript) at different times (5 ...
-
bioRxiv - Microbiology 2022Quote: ... was assembled from a PCR performed on a codon-optimized SARS-CoV-2 Omicron BA.1 sequence synthesized by Genscript. Fragments were assembled with a PCR fragment containing the fpl and mNG2(11 ...
-
bioRxiv - Cancer Biology 2024Quote: Gene blocks containing three fragments of the long isoform of NAB2-STAT6 (exons 1-4 of NAB2 and exons 2-22 of STAT6) with a c-terminal FLAG tag were ordered from GenScript. Using Gibson Assembly® Master Mix (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... Slot-RL and the recoded versions of pEGFP (pEGFP-1, EGFP-2), pRL (pRL1, pRL2 and pRL3) and N (p5’L-N1, pN1) were obtained from GenScript.
-
bioRxiv - Immunology 2024Quote: ... G12V-TCR alpha chain (1-206) and G12V-TCR beta chain (1-246) were synthesized by Genscript (USA) and cloned into the pET30a+ vector ...
-
bioRxiv - Bioengineering 2023Quote: ... The synthetic peptides AM1 (theoretical Mw = 2472 g·mol-1) and SurSi (theoretical Mw = 3632 g·mol-1) were designed in our lab and synthesized by GenScript® (Nanjing ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 μM CabTRP Ia (GenScript, Piscataway, NJ) was added to the saline ...
-
bioRxiv - Molecular Biology 2020Quote: ... rabbit anti-V5 (GenScript, 1:500 dilution), rabbit anti-HA (Cell Signaling ...
-
bioRxiv - Developmental Biology 2020Quote: ... rabbit anti-Blimp1 (1:1000, GenScript, A01647). Retinas were washed PBS ...