Labshake search
Citations for GenScript :
901 - 929 of 929 citations for Mouse Marginal Zone B And B1 Cell Specific Protein MZB1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: The Chinese hamster ovary (CHO-K1) cell line producing a recombinant mAb biosimilar of Trastuzumab was kindly donated by GenScript Biotech Corporation (Piscataway ...
-
bioRxiv - Neuroscience 2023Quote: ... SnifferOT cells were transiently transfected to express the red fluorescent genetically encoded calcium indicator R-GECO (GenScript, Piscataway, NJ, USA) with Fugene HD reagent (Promega ...
-
bioRxiv - Synthetic Biology 2023Quote: ... This was then back diluted 1:10 into DMEM-FBS media used for growing LLC-sppIP cells or fresh media containing synthetic sppIP peptide (Genscript). Media from LLC-sppIP cells was collected after 24 h of growth in 96 well plates.
-
bioRxiv - Immunology 2023Quote: ... SARS-CoV-2 sequences (Genbank accession number MN908947) were codon-optimized for Chinese Hamster Ovary (CHO) cells and synthesized by GenScript. Within the construct ...
-
bioRxiv - Immunology 2023Quote: DNA fragments that encode SARS-CoV-2 variant RBD (Spike 319-541) were codon-optimized for human cell expression and synthesized by Genscript. His-AVI tags were added at the end of the fragments ...
-
bioRxiv - Biochemistry 2024Quote: Cloning of hPINK1 constructs for insect cell expression and test purifications The coding sequences for the PINK1 constructs were PCR amplified using clone OHu25380D (Genscript) as a template and cloned into the vector pFB-6HZB (SGC ...
-
bioRxiv - Synthetic Biology 2023Quote: ... cells were transiently transfected with plasmids containing receptors of interest under eukaryotic expression promoters (ASGR1 was clone OHU03658D from GenScript), then split into 96-well plates (20,000 cells per well ...
-
bioRxiv - Microbiology 2024Quote: ... lentiviruses were generated in HEK293T cells by transfection of pLentiCRISPRv2 -Puro plasmid containing a single guide RNA (sgRNA) (GTACTGTAGATGGTGCTCAT) (GenScript) targeting ACE2 ...
-
bioRxiv - Microbiology 2023Quote: 8xHis-zz-TEV-mBICD2 (full-length or truncated 1-560) was codon optimized for expression in SF9 insect cells and synthesized by Genscript. The genes were subcloned into pFastBac using NEBuilder HiFi DNA assembly (NEB E2621S) ...
-
bioRxiv - Biochemistry 2024Quote: ... fused to consecutive C-terminal HA (hemagglutinin)- and FLAG-tags and cloned into pCDNA-3.1 plasmid for expression in HEK293 cells by the CMV (cytomegalovirus) promoter (GenScript Biotech). Mutant variants were generated by site directed mutagenesis (GenScript Biotech).
-
bioRxiv - Cell Biology 2024Quote: The human K6a sequence flanked by an amino-terminal HA tag and a carboxyl-terminal Flag tag (HA-hK6a-FLAG) was generated by PCR using pUC57-hK6a as a template which is codon-optimized for mammalian cell expression (Genscript). The sequence was inserted into lentiviral expression vector pCDH533-IRES-Neo (System Biosciences ...
-
bioRxiv - Cell Biology 2024Quote: ... Di-thiolated peptides that are susceptible to metalloproteinase (MMP) cleavage (GCNSVPMSMRGGSNCG) and thiolated cell-adhesive peptides (GCGYGRGDSPG) were obtained from Genscript. HA hydrogels were fabricated by mixing 4 wt% norbornene-modified HA with 0.05 wt% photo-initiator lithium phenyl-2,4,6-trimethylbenzoylphosphinate (LAP ...
-
bioRxiv - Immunology 2024Quote: ... spleen single cell suspensions were incubated for 4h at 37°C in the presence of gp33 peptide (1 µg/mL KAVYNFATC; Genscript), brefeldin A (5 µg/mL ...
-
bioRxiv - Microbiology 2024Quote: ... placed into the sample cell and titrated with 3.2–4.8 μl aliquots of 0.1–1 mM peptide solutions (purchased from GenScript, Piscataway, NJ, USA), 2 mM SAM or 250 µM SAH ...
-
bioRxiv - Cell Biology 2021Quote: PopZ and derived mutant constructs for expression in human cells were generated through custom synthesis and subcloning into the pcDNA3.1+N-eGFP backbone by Genscript (Piscataway, USA). The mCherry-G3BP1 plasmid was a kind gift of Dr ...
-
bioRxiv - Molecular Biology 2020Quote: ... AGO1/2 and AGO1/2/3 knockout cell lines used for RNAseq were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...
-
bioRxiv - Immunology 2021Quote: Antibodies inhibiting virus binding to host cell was measured using a commercial RBD-human angiotensin-converting enzyme 2 (hACE2) binding inhibition assay called cPASS™ (GenScript). As per manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... The gene sequence of hTRPA1 corresponding to Δ1-854 was optimised for expression in insect cells (GenScript Biotech, Piscataway, NJ, USA). The optimized gene fragment was cloned into the pTriEx-3 baculovirus donor plasmid ...
-
bioRxiv - Molecular Biology 2021Quote: ... and AGO1/2/3 knockout cell lines used for RNAseq were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...
-
bioRxiv - Microbiology 2023Quote: ... The harvested cell pellets were analysed by SDS-PAGE and probed by western blot with an anti-Flag antibody (Genscript A01868).
-
bioRxiv - Synthetic Biology 2023Quote: ... 50,000 cells were transferred to 300 µL volumes comprising a 10-fold dilution series of ɑ-factor (0-100 µM) (GenScript) dissolved in SC+1%DMSO ...
-
bioRxiv - Bioengineering 2019Quote: ... at 10 wt % solution (measured Young’s modulus at this condition21 corresponds with initial average measured elastic modulus of omental tissue45) with 2 mM of cell adhesion peptide GSPCRGDG (RGD, Genscript, Piscataway, NJ) and crosslinked with a 90 mM combination of the 1 kDa linear PEG-dithiol (JenKem ...
-
bioRxiv - Biochemistry 2024Quote: Codon optimized sequences of NAPstar3b and HyPer7 for expression in mammalian cells were commercially synthesized (Supplementary Table 4) (GenScript Biotech, Rijswijk, Netherlands) and delivered in pcDNA3.1(+ ...
-
bioRxiv - Immunology 2022Quote: ... the SARS-CoV-2 reference strain Spike ectodomain sequence (amino acids 1-1208 derived from Genbank accession number MN908947) was codon-optimized for Chinese Hamster Ovary (CHO) cells and synthesized by GenScript (Piscataway, NJ, USA). Within the construct ...
-
bioRxiv - Immunology 2021Quote: ... The synthetic transgene was codon optimized and engineered into the baculovirus vector (BV2373) for expression in Spodoptera frugiperda (Sf9) insect cells (GenScript, Piscataway, NJ, USA). NVX-CoV2373 spike trimers were detergent extracted from the plasma membrane with phosphate buffer containing TERGITOL NP-9 ...
-
bioRxiv - Immunology 2021Quote: The synthetic transgene was codon optimized and engineered into the baculovirus vector for expression in Spodoptera frugiperda (Sf9) insect cells (GenScript, Piscataway, NJ, USA). Spike trimers (designated CoV2373 ...
-
bioRxiv - Microbiology 2020Quote: ... The full-length S-genes were codon optimized for expression in Spodoptera frugiperda (Sf9) cells and synthetically produced by GenScript (Piscataway, NJ, USA). The QuikChange Lightning site-directed mutagenesis kit (Agilent ...
-
NVX-CoV2373 vaccine protects cynomolgus macaque upper and lower airways against SARS-CoV-2 challengebioRxiv - Immunology 2020Quote: NVX-CoV2327 was codon optimized synthetically produced from the full-length S glycoprotein gene sequence (GenBank MN908947 nucleotides 21563-25384) for expression in Spodoptera frugiperda (Sf9) cells (GenScript Piscataway, NJ, USA) as describe [1] ...
-
bioRxiv - Molecular Biology 2021Quote: ... Expression of METTL8 in stably-infected cell lines were characterized by immunoblotting with the anti-Strep antibody (THETM NWSHPQFEK antibody, Genscript, cat. No. A01732, 1:1000 dilution). Transient transfections of TWIN-Strep and FLAG-tagged proteins were also loaded onto BOLT 4–12% Bis-Tris gels ...