Labshake search
Citations for GenScript :
851 - 900 of 1147 citations for Ubiquitin Associated Protein 2 Like UBAP2L Antibody HRP since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... the fixed cells were labeled with primary antibodies including goat anti-major outer-membrane protein (MOMP; Meridian, Memphis, TN) and mouse or rabbit anti-six histidine tag (Genscript, Nanjing ...
-
bioRxiv - Molecular Biology 2022Quote: ... The genes for the designed HN protein variant 1 (HNv1) and F protein variant 1 (Fv1) were codon-optimized for expression in SJ and synthesized by Genscript® ...
-
bioRxiv - Molecular Biology 2022Quote: ... and AALA mutant were produced as GST-fused proteins by cloning the encoding ORF sequences into the pGEX-6P-1 plasmid (GenScript).
-
bioRxiv - Microbiology 2023Quote: ... The number and size of cleavage products were assessed by visualization of protein bands on 8-16% SurePAGE precast gels (GenScript) using MES SDS running buffer (GenScript ...
-
bioRxiv - Molecular Biology 2023Quote: We chose gene fragments encoding complete deaminase domains as well as extra N and C protein sequences for commercial synthesis (GenScript) (fig ...
-
bioRxiv - Microbiology 2023Quote: ... The gene encoding the phage CARD-only protein (pCARD) from Acinetobacter phage 133 (IMG gene accession 651703305) was synthesized and cloned by Genscript Corp ...
-
bioRxiv - Molecular Biology 2023Quote: The DNA sequences of all smORF proteins were synthesized and subcloned into a modified pRSET vector by GenScript (Hong Kong). The construct was tailored to have an N-terminal hexa-histidine-tagged lipoyl fusion protein followed by a thrombin cleavage site and the respective smORF protein ...
-
bioRxiv - Immunology 2023Quote: ... backbone and cDNA sequences for human NINJ1 (UniProtKB Q92982) or NINJ2 (UniProtKB Q9NZG7) protein with an N-terminal 3xFLAG tag and GSG linker were ordered from Genscript. For protein expression ...
-
bioRxiv - Biophysics 2023Quote: The binding affinities of wild-type Clr6S and Rpd3S proteins to the synthesized H3K36me3 peptide (ATKAARKSAPATGGVK36(me3)KPHRYRPG) (GenScript Biotech) were determined using BIAcore T200 system (GE Healthcare ...
-
bioRxiv - Cell Biology 2023Quote: ... 20-30ug of total protein per sample was loaded into wells of 4-12% Bis-Tris gels (Genscript or Invitrogen) and separated in MES or MOPS buffer ran at 65v for 30 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... The beads were washed with TAP-wash buffer and proteins were eluted using HA peptide (200 μg/ml; GenScript, RP11735) by shaking the beads in thermomixer at 1400 rpm for 45 min at 30 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 15-30 μg protein were loaded and separated by SDS-PAGE in 4–12% SurePAGE 12-well pre-cast gels (Genscript). Proteins were transferred onto PVDF membranes using iBlot or iBlot2 system (Thermo) ...
-
bioRxiv - Neuroscience 2023Quote: ... stephanieae’s transcriptome for the bioactive ELH peptide was translated into a predicted protein and synthesized by Genscript (Piscataway, NJ, USA) to 95 % purity ...
-
bioRxiv - Biochemistry 2024Quote: ... gene was codon-optimized and cloned into the p423_GAL1 yeast expression vector as an N-terminal Flag (DYKDDDDK) and C-terminal deca-histidine (10X His) tagged fusion protein (GenScript) (Supplementary Fig ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: The RBD-ACE2 assay was performed using SARS-CoV-2 sVNT ready to use kit sold by Genscript Inc ...
-
bioRxiv - Cancer Biology 2022Quote: ... and a portion was taken for replating (2×10^4 cells per replicate) with human (GenScript Z03034-50) or mouse (GenScript Z02767-10 ...
-
bioRxiv - Biochemistry 2021Quote: Full length SARS-CoV-2 nsp3 was codon optimized and cloned into a pcDNA-(+)-C-DYK vector (Genscript). Truncations were performed using primers listed in Table 1 ...
-
bioRxiv - Immunology 2022Quote: ... A total of 500,000 splenocytes were restimulated ex vivo with the full-length SARS-CoV-2 B.1.1.529 S 15-mer (overlapping by 11 amino acids) peptide pool (GenScript) in plates pre-coated with anti-IFN-γ or anti-IL-4 antibodies ...
-
bioRxiv - Plant Biology 2019Quote: ... PCR products were run in 2% agarose gel electrophoresis using a 100 bp DNA ladder (GenScript; CAT: M102O).
-
bioRxiv - Biochemistry 2020Quote: ... SARS-CoV-2 nsp7 gene (nucleotide 11846-12091, GenBank: MN908947.3) was synthesized de novo by GenScript (Nanjing, China) and cloned into the pMal-c5X vector using the same way as nsp8 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 5’ and 3’ end 2’-O-Methyl and phosphorothioate modified sgRNAs were synthesized by Genscript (Piscataway, NJ).
-
bioRxiv - Genetics 2020Quote: ... fragment 2 was generated by amplification of the kh recoded rescue fragment from a plasmid synthesized by GenScript Inc. ...
-
bioRxiv - Immunology 2021Quote: ... a commercial competitive ELISA SARS-CoV-2 Surrogate Virus Neutralization Test (sVNT) was used (Genscript, New Jersey, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... The loaf sgRNA sequences GCTGGTGATTACGTCGGTGA (loaf gRNA 1) and TGCGGGACCATCCGGGTACC (loaf gRNA 2) identified on www.flyrnai.org/crispr2 were made with gene synthesis in pUC57 (GenScript) and cloned into pCFD4 (Port et al ...
-
bioRxiv - Biophysics 2022Quote: The codon-optimized gene encoding the nsp7-10 region of SARS-CoV-2 polyprotein was synthesized commercially (GenScript) and cloned between the NdeI and XhoI sites of pET15b vector ...
-
bioRxiv - Plant Biology 2023Quote: ... The clarified cell lysate was incubated with 2 ml pre-equilibrated Ni2+ charged magnetic resin purchased from GenScript. Briefly ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1% penicillin-streptomycin) supplemented with 50 mM 2-mercaptoethanol and 1 μg/ml OVA257-264 (SIINFEKL) peptide (GenScript) at at 37 °C and 5% CO2 for 3 days ...
-
bioRxiv - Immunology 2023Quote: ... 50 μl of phycoerythrin (PE)– conjugated human angiotensin-converting enzyme 2 (ACE2) (hACE2; 1 μg per milliliter; GenScript) was added to the well and incubated for 30 minutes at 37°C with agitation ...
-
bioRxiv - Biochemistry 2019Quote: ... we designed and purchased an anti-horse-SLN polyclonal antibody from Genscript (pAb GS3379). The immunogen was a 6-residue N-terminal peptide of horse SLN (Q1MEWRRE6C) ...
-
bioRxiv - Developmental Biology 2020Quote: ... A primary antibody specifically for zebrafish was used to detect Esco2 (1:1000, GenScript). Alexa 546 anti-rabbit (1:1000 ...
-
bioRxiv - Microbiology 2020Quote: ... EsxA and SodA were generated for this study (Customer’s Antigen Polyclonal Antibody Package, Genscript). C-terminally his6-tagged SiEsaA41-871 ...
-
bioRxiv - Microbiology 2021Quote: ... Western blot using a mouse anti-Histidine tag monoclonal Antibody (Genscript Cat. No. A00186) was used to confirm purity of the purified protein (Figure-1S) ...
-
bioRxiv - Immunology 2022Quote: ... The polypeptide antibody against shrimp NLRP3 (aa29-42) was prepared by GenScript (Nanjing, China).
-
bioRxiv - Microbiology 2022Quote: ... which were coated in anti-HIS antibody [Biotin] (GenScript A00613, mouse IgG1k clone 6G2A9) at 2.5 μg/mL ...
-
bioRxiv - Biophysics 2022Quote: ... Biotin-labeled mouse monoclonal antibody against the Strep-tagII (“NWSHPQFEK”) was purchased from Genscript (GenScript Cat# A01737 ...
-
bioRxiv - Cell Biology 2022Quote: ... Slc37a2 peptide antibodies were produced using the PolyExpressTM service by GenScript (New Jersey, USA).
-
bioRxiv - Microbiology 2020Quote: ... GrgA and mutants were detected using a monoclonal anti-His antibody (Genscript, Cat. A00186) and a mouse anti-GrgA antibody (35).
-
bioRxiv - Biochemistry 2020Quote: A custom-made mouse monoclonal antibody against the isoDGR motif was prepared by GenScript Corporation (Piscataway ...
-
bioRxiv - Microbiology 2021Quote: ... 0.2% Tween-20) for 30 min and probed with CaBcy1 rabbit polyclonal antibody (GenScript) or CaTpk2 rabbit polyclonal antibody (GenScript) ...
-
bioRxiv - Biochemistry 2022Quote: ... The following phospho-specific antibodies were used: pS384-RPA70 (monoclonal, custom generated by Genscript), pS10-Histone H3 (Cell Signaling ...
-
bioRxiv - Immunology 2022Quote: ... the four genes for each multispecific antibody were synthesized using human preferred codons (GenScript) and cloned into eukaryotic expression vectors ...
-
bioRxiv - Microbiology 2023Quote: ... Membranes were probed with an anti-EsxA1 rabbit polyclonal antibody (0.5 μg/ml; GenScript) in the above LI-COR blocking buffer overnight at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... The variable regions of heavy and light chains for each antibody were synthesized (GenScript), cloned into gWiz or pCDNA3.4 vector ...
-
bioRxiv - Microbiology 2022Quote: ... The following antibodies were used: rabbit anti-GST (GenScript, A00097, 1:2000 for WB), rabbit anti-Flag (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... TotA was used as immunogen to produce rabbit anti-TotA antibody (made by GenScript).
-
bioRxiv - Microbiology 2023Quote: ... anti-VHH monoRab antibody conjugated to horse-radish peroxidase (Genscript, catalogue number A01861-200) was added at a concentration of 0.2 µg/mL (0.1 mL per well ...
-
bioRxiv - Immunology 2023Quote: ... A CM5 chip with covalently immobilized anti-Avi polyclonal antibody (GenScript, Cat #: A00674-40) was used for surface capture of His-Avi tag containing RBDs ...
-
bioRxiv - Immunology 2023Quote: ... Transduced cells were detected by eGFP expression or by an anti-VHH antibody (Genscript) directed against the nanobody constituting the extracellular domain of the CAR and analyzed by flow cytometry.
-
bioRxiv - Cell Biology 2023Quote: ... membranes were incubated with either anti-FLAG antibody conjugated to iFluor 488 (GenScript A01809) at 1:2,000 dilution ...
-
bioRxiv - Immunology 2024Quote: ... and incubated with FITC conjugated anti-FLAG mouse monoclonal antibody (GenScript, Cat. No. A01632) at a concentration of 2 µg per million cells for 1 hr at 37 C in the dark ...