Labshake search
Citations for GenScript :
801 - 850 of 960 citations for Human Gap Junction Alpha 8 Protein CX50 GJA8 ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: We chose gene fragments encoding complete deaminase domains as well as extra N and C protein sequences for commercial synthesis (GenScript) (fig ...
-
bioRxiv - Plant Biology 2023Quote: ... Colonies exhibiting VENUS fluorescence and an AphVII cassette knock-in at the CAS9 target site were examined for accumulation of the CreTPT3 protein by immunodetection using CreTPT3 antibodies generated by GenScript USA Inc (Piscataway ...
-
bioRxiv - Microbiology 2023Quote: ... The gene encoding the phage CARD-only protein (pCARD) from Acinetobacter phage 133 (IMG gene accession 651703305) was synthesized and cloned by Genscript Corp ...
-
bioRxiv - Developmental Biology 2023Quote: ... 0.25% DMSO) (refer to Fig. 1C) in the presence or absence of SARS-CoV-2 spike protein (5ng/mL; GenScript). Controls were kept in the treatment solution with only DMSO ...
-
bioRxiv - Molecular Biology 2023Quote: The DNA sequences of all smORF proteins were synthesized and subcloned into a modified pRSET vector by GenScript (Hong Kong). The construct was tailored to have an N-terminal hexa-histidine-tagged lipoyl fusion protein followed by a thrombin cleavage site and the respective smORF protein ...
-
bioRxiv - Immunology 2023Quote: ... backbone and cDNA sequences for human NINJ1 (UniProtKB Q92982) or NINJ2 (UniProtKB Q9NZG7) protein with an N-terminal 3xFLAG tag and GSG linker were ordered from Genscript. For protein expression ...
-
bioRxiv - Molecular Biology 2022Quote: ... and AALA mutant were produced as GST-fused proteins by cloning the encoding ORF sequences into the pGEX-6P-1 plasmid (GenScript).
-
bioRxiv - Biochemistry 2024Quote: ... gene was codon-optimized and cloned into the p423_GAL1 yeast expression vector as an N-terminal Flag (DYKDDDDK) and C-terminal deca-histidine (10X His) tagged fusion protein (GenScript) (Supplementary Fig ...
-
bioRxiv - Neuroscience 2023Quote: ... stephanieae’s transcriptome for the bioactive ELH peptide was translated into a predicted protein and synthesized by Genscript (Piscataway, NJ, USA) to 95 % purity ...
-
bioRxiv - Cell Biology 2023Quote: ... 15-30 μg protein were loaded and separated by SDS-PAGE in 4–12% SurePAGE 12-well pre-cast gels (Genscript). Proteins were transferred onto PVDF membranes using iBlot or iBlot2 system (Thermo) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The beads were washed with TAP-wash buffer and proteins were eluted using HA peptide (200 μg/ml; GenScript, RP11735) by shaking the beads in thermomixer at 1400 rpm for 45 min at 30 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... The genes for the designed HN protein variant 1 (HNv1) and F protein variant 1 (Fv1) were codon-optimized for expression in SJ and synthesized by Genscript® ...
-
bioRxiv - Immunology 2022Quote: ... The recombinant monoclonal antibodies of IgG subtypes were purified after incubation of filtered Expi293F cell supernatant with Protein G resin beads (GenScript) at 4°C overnight ...
-
bioRxiv - Immunology 2022Quote: ... for 30 minutes before being exposed with 100 ng/mL of Sars-CoV-2 spike protein (RBD, HisTag) (Cat. ZO3483-1-GenScript) at different times (5 ...
-
bioRxiv - Biophysics 2023Quote: The binding affinities of wild-type Clr6S and Rpd3S proteins to the synthesized H3K36me3 peptide (ATKAARKSAPATGGVK36(me3)KPHRYRPG) (GenScript Biotech) were determined using BIAcore T200 system (GE Healthcare ...
-
bioRxiv - Developmental Biology 2024Quote: The antibodies used in this study were as follows: A custom antibody against ExoA was generated in rabbits using purified full-length protein as the antigen (GenScript). Mouse Polyglycylated-tubulin antibody (1:1000 ...
-
bioRxiv - Biophysics 2024Quote: Antibodies were obtained from the following sources: Protein C-Tag Antibody (HPC4) (Rabbit polyclonal) was from Genscript (Piscataway, NJ, USA); Anti-Phosphotyrosine Antibody ...
-
bioRxiv - Immunology 2024Quote: 15-mer peptides with 11 amino acids overlap that cover the full length of S protein of SARS-CoV-2 were synthesized (GenScript). Peptides were dissolved in DMSO at 12 mg/ml and 12-15 peptides were mixed to create 26 different semi-pools ...
-
bioRxiv - Immunology 2024Quote: ... custom 15mer OLPs with 11 amino acid overlap were generated spanning the SARS-CoV-2 Spike RBD WH-01 protein (amino acids R319-S591, GenScript). WH-01 peptides that contained VOC mutation loci were substituted with the corresponding mutant sequences when applicable ...
-
bioRxiv - Molecular Biology 2024Quote: ... [32] Protein purity was confirmed by sodium-dodecyl-sulfate polyacrylamide electrophoresis (SDS-PAGE) on 4-15% gradient gels (Genscript, USA) stained with 0.0025% w/v each of Coomassie® Brilliant Blue G-250 and R-250 in 10% v/v ethanol ...
-
bioRxiv - Biochemistry 2024Quote: ... and a synthetically added sequence for the Small Ubiquitin-like Modifier (SUMO) protein (Uniprot ID Q12306) was commercially appended (GenScript). The entire sequence was then subcloned into the pET-45b(+ ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... rosetta synaptobrevin a codon-optimised nucleotide sequence encoding the soluble portion of the protein [Syb (1-75)] was prepared by gene synthesis (Genscript, USA): GAGGCGAACCGTACCGGTGACTACCGTCTGCAGGAAGCGCAGCGTCAAGTGGGCGAAGTT CAAAACGTGATGCGTGATAACCTGACCAAGGTTATCGAGCGTGGTGAAAAACTGGACGATC TGGACGCGAAGGCGGAAGATCTGGAGGCGGAGGGTCAGCGTTTCCAAAACCGTGCGGGCC GTCTGCGTCGTCAGATGTGGTGGCAAAACAAACGTAACCAGTAA
-
bioRxiv - Developmental Biology 2022Quote: ... The protein was eluted using elution buffer (50mM Tris-HCL,7.4, 100mM NaCl, 1mM EGTA, Flag peptide (GenScript, 300 μg/ml). The isolated proteins were then prepared for mass spectrometry using an in-solution protein digestion kit (Thermo Scientific) ...
-
bioRxiv - Bioengineering 2021Quote: Purified RfxCas13d proteins and synthetic crRNAs were mixed (unless otherwise indicated) at 2:1 molar ratio in Buffer 1 (GenScript SC1841) or Buffer 22 (25mM Tris pH 7.5 ...
-
bioRxiv - Biochemistry 2021Quote: ... FLAG-tagged proteins were released from the resin by incubation with buffer supplemented with 50 mM FLAG peptide (Genscript, Piscataway, NJ) for 30 min.
-
bioRxiv - Microbiology 2020Quote: ... were coated overnight at 4°C with 2μg/ml of recombinant SARS-CoV-2 S1-RBD protein (GenScript No. Z03483-1) in carbonate-bicarbonate buffer (Sigma Aldrich No ...
-
bioRxiv - Microbiology 2021Quote: ... of SARS-CoV-2 spike protein to Angiotensin Converting Enzyme (ACE2) was assessed via the Surrogate Virus Neutralization Test (GenScript# L00847) using the included kit protocol modified per the following ...
-
bioRxiv - Biophysics 2020Quote: ... The identities of purified HA-TIN2S and HA-TIN2L proteins were confirmed by the Western Blot analysis using the HA antibody (GenScript A00168), and MALDI-TOF mass spectrometry analysis (UNC-Chapel Hill Proteomics Center) ...
-
bioRxiv - Cell Biology 2020Quote: ... and for generation of EGFP-C2-Arp3B plasmid, the mRNA transcript variant 1 encoding murine actin-related protein 3B (Actr3b) (Jay et al., 2000) was synthesized (GenScript Biotech) and cloned into pEGFP-C2 vector (Clontech).
-
bioRxiv - Cell Biology 2022Quote: ... 20-50 μg of protein lysate of each sample was loaded and separated on 4-12% Bis-Tris gels (Thermo Fisher or GenScript) according to manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... were coated overnight with 250 ng/well of purified recombinant Coronavirus proteins and 500 ng/well of a SARS-CoV-2 fusion sequence-containing peptide (KRSFIEDLLFNKVTLADAGFIK, GenScript Biotech). After washings with 0.05% Tween 20-PBS (washing buffer) ...
-
bioRxiv - Biochemistry 2022Quote: Sequences encoding the 3CL-pro and RBD proteins were codon optimized for expression in Escherichia coli and cloned into the pET-28a(+) vector (Genscript Biotech). The chimeric protein 3CLpro-RBD was produced by generating a gene construct that linked the 3CL-pro and RBD genes by a bridge sequence that encoded for glycine-proline triple repeat (GPGPGP ...
-
bioRxiv - Molecular Biology 2020Quote: ... vector containing DENV2C protein gene sequence with N-terminal His tag and Tobacco Etch Virus (TEV) digestion site was purchased from GenScript (China). Recombinant capsid protein from DENV2 NGC strain was expressed in Escherichia coli BL21 strain ...
-
bioRxiv - Microbiology 2021Quote: ... active protein fractions were further separated through sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE; 4%–20% Bis-Tris Gel; GenScript, USA). Proteins in the gel slices were eluted in HEPES-K+ buffer (50 mM ...
-
bioRxiv - Microbiology 2021Quote: ... of SARS-CoV-2 spike protein to Angiotensin Converting Enzyme (ACE2) was assessed via the Surrogate Virus Neutralization Test (GenScript# L00847) using the included kit protocol modified per the following ...
-
bioRxiv - Microbiology 2020Quote: ... class C-like β-lactamase protein (gi|919167542) and the Elizabethkingia GOB-13 (AY647250) were synthesized by GenScript (Piscataway, NJ, USA) and optimized for protein expression in Escherichia coli in the pET24a(+ ...
-
Novel mRNA vaccines encoding Monkeypox virus M1R and A35R protect mice from a lethal virus challengebioRxiv - Immunology 2022Quote: M1R and A35R protein sequences from MPXV strain Zaire79 were used to reversely translate to their coding sequences by GenSmart™ Codon Optimization (GenScript). The A35R extracellular domain was fused with M1R by a peptide linker was also synthesized ...
-
bioRxiv - Biochemistry 2024Quote: ... Cell debris were removed by centrifugation (10,000 x g for 10 min at 4°C) and the supernatant was incubated with 30 μL of protein A/G-coated magnetic beads (Genscript L00277) for 1 hour at 4 °C to remove nonspecifically bound proteins ...
-
bioRxiv - Molecular Biology 2023Quote: ... the beads were washed thoroughly with the IP buffer and the bound proteins were eluted with 200 μg/ml Flag (DYKDDDDK) peptide (GenScript, RP10586) in thermomixer at 4 °C ...
-
bioRxiv - Microbiology 2023Quote: ... Fusion proteins were generated for the assay by cloning chlamydial DNA sequences encoding CPAF into a pET30a vector (constructed by Genscript Biotech), resulting in fusion proteins with a hexahistidine (His6 ...
-
bioRxiv - Molecular Biology 2022Quote: Equal sample concentrations (100 μg of total protein per well) were resolved in 4%–20% electrophoresis gradient gels (Genscript, Cat. M00656) and transferred onto polyvinylidene difluoride (PVDF ...
-
bioRxiv - Plant Biology 2022Quote: ... Sequences starting after the residue corresponding to butelase-1-L26 or after the signal peptide predicted using SignalP5.0 were cloned into the pET28a(+) vector at Ndel/Xhol restriction sites to generate a His6-fusion protein construct (Genscript, USA). Point mutations were generated using a Q5 mutagenesis kit (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: ... Genes encoding pyocin SX1 and SX2 and associated immunity proteins (GenBank records ON716475-ON716476) were codon optimized and synthesized (GenScript, USA) for expression in E ...
-
bioRxiv - Microbiology 2024Quote: ... Ni Column was used for protein purification and the purity was confirmed >90% by SDS-PAGE and specificity of the protein was confirmed by western blotting using mouse anti-His mAb (GenScript # A000186). Excess endotoxin level was removed to keep its level < 1 EU/µg of protein ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 ug protein samples were boiled at 90°C for 5 minutes in LDS sample buffer (Genscript#M00676 or Millipore#MPSB) containing 5% 2-mercaptoethanol ...
-
bioRxiv - Biophysics 2024Quote: ... a pGEX-4T-1 vector coding for SH downstream of a GST carrier protein and a thrombin cleavage site was acquired from GenScript (US). The plasmid was transformed into competent E ...
-
bioRxiv - Neuroscience 2024Quote: ... and the tracrRNA were injected with 200 ng/µl of recombinant Cas9 protein (Integrated DNA Technologies) and 10 ng/µl of a single-stranded DNA template (Megamer® single-stranded DNA fragment, GenScript) into the pronucleus of B6D2F2 zygotes which were subsequently transferred to pseudopregnant CD1 mice ...
-
bioRxiv - Cancer Biology 2024Quote: ... NUSAP1-whole-mCherry (amino acids 1-441) and YY1-whole-mCherry (amino acids 1-414) fusion protein was synthesized by GenScript (Piscataway). Potassium phosphate buffer (pH 7.0 ...
-
bioRxiv - Bioengineering 2020Quote: ... and measured by ToxinSensor Chromogenic LAL Endotoxin Assay Kit (Genscript). The purified Nbs were further sterilized by passing a 0.2 μm filter (Millex ...
-
bioRxiv - Immunology 2020Quote: For the surrogate neutralization assay the cPass kit from GenScript was used (Cat ...