Labshake search
Citations for GenScript :
801 - 850 of 888 citations for 4 1 tert butoxycarbonyl piperidin 3 yl benzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... and synthesized and cloned into the pET-DUET-1 vector with a C-terminal Tobacco Etch Virus (TEV) protease cleavage site (ENLYFQG) and hexahistidine tag (His6) (GenScript). The expression construct was transfected into E ...
-
bioRxiv - Microbiology 2023Quote: 8xHis-zz-TEV-mBICD2 (full-length or truncated 1-560) was codon optimized for expression in SF9 insect cells and synthesized by Genscript. The genes were subcloned into pFastBac using NEBuilder HiFi DNA assembly (NEB E2621S) ...
-
bioRxiv - Biochemistry 2024Quote: ... the RBD and subdomain-1 (RBD-SD1, residues 307-675) and human TMPRSS2 (residues 107-492, NCBI accession O15393) were obtained from Genscript. Cloning and mutagenesis of those genes were also performed by Genscript ...
-
bioRxiv - Developmental Biology 2024Quote: ... Transfer was done at 20 V for 1 hour buffer containing 25 mM Tris base and 25 mM Bicine (M00139, GenScript) supplemented with 10% absolute ethanol (20821.330 ...
-
bioRxiv - Immunology 2024Quote: ... 293F cells were transfected with plasmids containing Spike protein (ATUM plasmid pD2528-CMV with insert QHD43416.1) and Spike-2P protein (site-directed mutagenesis to generate the 2P mutation on the plasmid containing Spike protein, GenScript) by 293fectinTM transfection reagent (Gibco ...
-
bioRxiv - Immunology 2024Quote: ... spleen single cell suspensions were incubated for 4h at 37°C in the presence of gp33 peptide (1 µg/mL KAVYNFATC; Genscript), brefeldin A (5 µg/mL ...
-
bioRxiv - Microbiology 2024Quote: ... placed into the sample cell and titrated with 3.2–4.8 μl aliquots of 0.1–1 mM peptide solutions (purchased from GenScript, Piscataway, NJ, USA), 2 mM SAM or 250 µM SAH ...
-
bioRxiv - Neuroscience 2023Quote: ... while the Copiagag antibodies were generated against a Copia peptide antigen (see Figure 1) by immunizing rabbits with the peptide LMVVKNSENQLADIC (GenScript).
-
bioRxiv - Synthetic Biology 2023Quote: ... This was then back diluted 1:10 into DMEM-FBS media used for growing LLC-sppIP cells or fresh media containing synthetic sppIP peptide (Genscript). Media from LLC-sppIP cells was collected after 24 h of growth in 96 well plates.
-
bioRxiv - Biophysics 2024Quote: ... TTR type was determined by transferring the gel contents to a 0.2 µm nitrocellulose membrane and probing with a primary antibody (1:1000) directed against the C-terminal region of the wild type TTR sequence (GenScript). Horseradish peroxidase-conjugated goat anti-rabbit IgG (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... pcDNA3.1 encoding CoV-2 Omicron (BA.1) Spike tagged with a His epitope on the N-terminus was synthesized provided by Genscript. pMD2.G encoding VSV-G (12259 ...
-
bioRxiv - Biochemistry 2022Quote: ... The hexahistidine tag and Sso7dmut were cleaved from HIV-1 IN by addition of his-tagged sortase and GGGC peptide (GenScript). The reaction was exposed to nickel resin to remove sortase and any residual uncleaved IN ...
-
bioRxiv - Biophysics 2022Quote: ... construct cloned in a pGEX-6P-1 vector with an N terminal GST-tag followed by a precision protease site was obtained from GenScript.
-
bioRxiv - Immunology 2022Quote: ... for 30 minutes before being exposed with 100 ng/mL of Sars-CoV-2 spike protein (RBD, HisTag) (Cat. ZO3483-1-GenScript) at different times (5 ...
-
bioRxiv - Microbiology 2022Quote: ... was assembled from a PCR performed on a codon-optimized SARS-CoV-2 Omicron BA.1 sequence synthesized by Genscript. Fragments were assembled with a PCR fragment containing the fpl and mNG2(11 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: nLucWT/K0-RIPK1KD (kinase domain 1-324) fusion gene with a 24-residue flexible linker in between (SGGRSSGSGSTSGSGTSLYRRVGT) was synthesized and codon optimized by GenScript and cloned into pcDNA3.1 backbone ...
-
bioRxiv - Microbiology 2024Quote: ... A 100 µL (1:20,000 dilution) of Mouse Anti-Rabbit IgG Fc monoclonal antibody (mAb, 14H9H10) conjugated with HRP (GenScript # A01856) was added to each well and incubated at 37 °C for 30 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... The gel content was transferred onto a 0.2 μm nitrocellulose membrane and incubated it with a primary antibody (1:1000) targeting the C-terminal region of the wild-type TTR sequence from GenScript. The secondary antibody was horseradish peroxidase-conjugated goat anti-rabbit IgG (dilution 1:1000 ...
-
bioRxiv - Microbiology 2024Quote: ... The best performing monoclonal antibody ‘A11-1’ was chosen for DNA sequencing (see supplementary material) and recombinant antibody production by Genscript Biotech.
-
bioRxiv - Molecular Biology 2024Quote: ... Slot-RL and the recoded versions of pEGFP (pEGFP-1, EGFP-2), pRL (pRL1, pRL2 and pRL3) and N (p5’L-N1, pN1) were obtained from GenScript.
-
bioRxiv - Biophysics 2024Quote: ... followed by probing with a primary antibody (diluted 1:1000) targeting the C-terminal region of the wild type TTR sequence (GenScript). Horseradish peroxidase-conjugated goat anti-rabbit IgG (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... AA 1-154) of Aquifex aeolicus were fused by a Gly-Ser linker and constructed in a pUC57 plasmid by GenScript USA ...
-
bioRxiv - Molecular Biology 2024Quote: ... was identified by transferring the gel contents onto a 0.2 μm nitrocellulose membrane and probing it with a primary antibody (1:1000) targeting the C-terminal region of the wild-type TTR sequence from GenScript. A secondary antibody ...
-
bioRxiv - Cancer Biology 2024Quote: ... miR-19a and the NTC sequences were encoded into the pre-miR-30-based short hairpin cassette flanked with MLU-1 restriction (GenScript). Both miRNA-encoding plasmids and MG1 shuttle plasmids were digested using MLU-1 (NEB ...
-
bioRxiv - Biophysics 2024Quote: ... and deletion of residues 1-20 (mj-120, with Met1 at position 20) were encoded into the pET21a(+) vector (Genscript). Protein expression constructs used in this study did not include solubility or purification tags ...
-
bioRxiv - Cell Biology 2024Quote: ... the cytosol-exposed domain of CCPG1 (1-212aa) fused to a C-terminal GST-tag was gene synthesized by Genscript and cloned into a pET-DUET1 vector ...
-
bioRxiv - Cell Biology 2024Quote: ... the cytosol-exposed domain of FKBP8 (1-391aa) fused to a C-terminal GST-tag was gene synthesized by Genscript and cloned into a pET-DUET1 vector ...
-
bioRxiv - Cell Biology 2024Quote: ... was established from screening hybridomas generated from mice immunized with purified N-terminus of mouse CATSPER1 (1-150 aa; GenScript) followed by Protein G affinity purification.
-
bioRxiv - Biochemistry 2024Quote: Genes encoding Ndas1146 (Uniprot: D7B1W6) and Ndas1147 (Uniprot: D7B1W7) from Nocardiopsis dassonvillei were cloned into a pRSFDuet-1 vector by Genscript. Before further use ...
-
bioRxiv - Cell Biology 2024Quote: The Golgin84-HA-OMP DNA construct contains human GOLGA5 (residues 1-698) fused with HA epitope and C-terminal transmembrane domain of OMP25 (aa 110-145) was synthesized by GenScript and subcloned into pcDNA3.1 ...
-
bioRxiv - Microbiology 2020Quote: ... the recombinant protein of the extracellular domain of human ACE2 (aa 1-740) fused to Fc (ACE2-Fc, Genscript, Nanjing, China) was coated on 96-well microtiter plate (50 ng/well ...
-
bioRxiv - Biophysics 2021Quote: ... at C-terminal was cloned into pGEX-6P-1 vector at BamHI and XhoI sites using gene synthesis and cloning services (GenScript, USA). The plasmid was transformed into E ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... rosetta synaptobrevin a codon-optimised nucleotide sequence encoding the soluble portion of the protein [Syb (1-75)] was prepared by gene synthesis (Genscript, USA): GAGGCGAACCGTACCGGTGACTACCGTCTGCAGGAAGCGCAGCGTCAAGTGGGCGAAGTT CAAAACGTGATGCGTGATAACCTGACCAAGGTTATCGAGCGTGGTGAAAAACTGGACGATC TGGACGCGAAGGCGGAAGATCTGGAGGCGGAGGGTCAGCGTTTCCAAAACCGTGCGGGCC GTCTGCGTCGTCAGATGTGGTGGCAAAACAAACGTAACCAGTAA
-
bioRxiv - Cell Biology 2020Quote: ... consensus sequence was obtained from RepeatMasker and/or from repbase (http://www.repeatmasker.org/) synthetized and cloned into pUC57 by GenScript (Supplementary Table 1). To make the IAPEz reporter (pTCH1) ...
-
bioRxiv - Cell Biology 2021Quote: ... were transfected with individual shRNA in pLKO.1 (Broad Institute, Cambridge, MA) mixed with packaging plasmid pCMV-dR8.91 (G193486, GenScript, Piscataway, NJ) and envelope plasmid pVSV-G (G178153 ...
-
bioRxiv - Immunology 2021Quote: ... and beta (1-244) chains were synthesized and cloned into the bacterial expression vector pET30a via NdeI and XhoI (Genscript, USA). Proteins were expressed as inclusion bodies in BL21 (DE3 ...
-
bioRxiv - Cell Biology 2020Quote: ... and for generation of EGFP-C2-Arp3B plasmid, the mRNA transcript variant 1 encoding murine actin-related protein 3B (Actr3b) (Jay et al., 2000) was synthesized (GenScript Biotech) and cloned into pEGFP-C2 vector (Clontech).
-
bioRxiv - Immunology 2021Quote: ... The wells were washed six times with PBS-T and incubated with 100 µL (1:10000) of Goat Anti Mouse IgG (Genscript, USA) or Anti Hamster IgG (Abcam ...
-
bioRxiv - Plant Biology 2020Quote: ... 1.5 μg of MEA or 1.5 μg of CLF (PRC2) complexes were incubated with 1 μg of Histone H3 peptides (GenScript, Piscataway, NJ) and 1.5 μCi of 3H-SAM (Perkin Elmer ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Mammalian plasmid pcDNA3.1(+)-pHluorin was made by synthesizing and cloning a codon optimized sequence of pHluorin into the pcDNA3.1(+) backbone (GenScript; Piscataway, NJ).
-
Development of monoclonal antibody-based blocking ELISA for detecting SARS-CoV-2 exposure in animalsbioRxiv - Microbiology 2023Quote: ... The SARS-CoV-2 full-length N gene of Wuhan-hu-1 isolate (GenBank # NC 045512.2) was synthesized (GenScript, Piscataway, NJ) and cloned in the pET-28a (+ ...
-
bioRxiv - Immunology 2023Quote: DNA encoding for residues 24-167 of the extracellular portion of human PD-1 (UniProt Q15116) with a C-terminus histidine tag or corresponding PD-1 N58Q mutant were cloned into pcDNA3.4 by GenScript (Piscataway, NJ). Expi293 cells were transiently transfected with plasmid DNA mixed with PEI (Polysciences ...
-
bioRxiv - Neuroscience 2022Quote: We generated the UAS-syt1GCaMP6F construct by cloning the cDNA sequence of Drosophila synaptotagmin 1, a 3x GS linker, and the GCaMP6F sequence into the pJFRC7-20XUAS vector (Pfeiffer et al., 2010) (Genscript Biotech). The GS linker connects the C-terminus of syt1 to the N-terminus of GCaMP6F (after Cohn et al. ...
-
bioRxiv - Microbiology 2023Quote: ... The solution was replaced with blocking buffer with appropriate dilutions of primary antibody (1:500 Rabbit anti-ChmC (Genscript, custom-generated) or 1:2,000 Rabbit anti-OmpA ...
-
bioRxiv - Biochemistry 2022Quote: ... The gene sequences for the PDZ domain of human PDLIM7 (1-84) and various point mutants were synthesised as codon optimised constructs and cloned into pET30b(+) by Genscript (USA) for bacterial expression with an N-terminal 6His-tag.
-
bioRxiv - Cancer Biology 2022Quote: ... SdAb detection was performed using (1:20000) MonoRab™ Rabbit Anti-Camelid VHH Antibody conjugated to HRP (GenScript, Cat. # A01861-200) in MTBST 0.05% ...
-
bioRxiv - Microbiology 2022Quote: ... the chromatography column was resuspended with 1 ml TCB as well as 20 μl (200 U) of TE protease enzyme (Genscript, Inc) on a rotator and the columns incubated at 4°C for 16 hours ...
-
bioRxiv - Synthetic Biology 2024Quote: DROP-CAR expression in B3Z cells was evaluated via labeling with a 1:200 dilution of biotinylated anti-Strep tag antibody (GenScript, A01737) binding the TMD-containing chain of the DROP-CAR ...
-
bioRxiv - Microbiology 2024Quote: ... the membranes were incubated with an anti-Strep tag II antibody (THE™ NWSHPQFEK Tag Antibody, GenScript, USA, 1:1000 dilution) to detect Strep-tagged nsp1 and with an anti-GAPDH mouse-antibody (1:1000 dilution ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit polyclonal anti-AQP4ex generated against the peptide DSTEGRRDSLDLASC within the AQP4 C-terminus (1:1000; GenScript Biotech, Piscataway, NJ, USA), mouse monoclonal anti- OMP (1:300 ...