Labshake search
Citations for GenScript :
801 - 850 of 1109 citations for 2 Chloro 1 1 trifluoromethyl 1 3 4 9 tetrahydro 2H beta carbolin 2 yl ethan 1 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: Plasmids encoding full-length or truncated proteins from SARS-COV-2 (clinical isolate Australia/VIC01/2020) tagged at the N-terminus with eGFP were generated by GenScript in pcDNA 3.1-N-eGFP ...
-
bioRxiv - Immunology 2024Quote: ... custom 15mer OLPs with 11 amino acid overlap were generated spanning the SARS-CoV-2 Spike RBD WH-01 protein (amino acids R319-S591, GenScript). WH-01 peptides that contained VOC mutation loci were substituted with the corresponding mutant sequences when applicable ...
-
bioRxiv - Immunology 2024Quote: DNA fragments that encode SARS-CoV-2 variant RBD (Spike 319-541) were codon-optimized for human cell expression and synthesized by Genscript. His-AVI tags were added at the end of the RBD gene fragments ...
-
bioRxiv - Plant Biology 2024Quote: ... 0.2 uM of 6xHis-SUMO-UBA and GST/GST-ERC1 FL were incubated with Ni-Charged NTA magnetic resins (GenScript) in the reaction buffer (50mM imidazole ...
-
bioRxiv - Plant Biology 2024Quote: MtAPI and MtHAPI1 mCitrine-tagged variants were synthesised with flanking Gateway-compatible attL1/2 sites and cloned into pUC57 by Genscript. The mCitrine CDS was inserted with a short N-terminal linker sequence (linker-mCitrine ...
-
bioRxiv - Biochemistry 2024Quote: ... Supernatant from centrifugation at 12000 rpm for 45 min was applied to 2 mL of Anti-DYKDDDDK G1 Affinity Resin (GenScript) which was washed five times by 5 mL of wash buffer I (25 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Expression constructs encoding ERBB4 JM-a CYT-2 point mutants listed in Supplementary Table S1 were created by cloning mutant inserts from pDONR221-vectors (Genscript) into pBABE-puro-gateway retroviral mammalian expression vector (a gift from Matthew Meyerson ...
-
bioRxiv - Biochemistry 2024Quote: The TRI2-2 and influenza virus minibinders were cloned into pET29b between the NdeI and XhoI restriction sites by Genscript. The TRI2-2 minibinder was cloned with a C-terminal polyhistidine tag and the influenza minibinder was cloned with an N-terminal polyhistidine tag17 ...
-
bioRxiv - Plant Biology 2024Quote: ... Guide RNA sequences “5-CGUGUCACGACGGAGUGGAU-3” and “5-AUGUUGUAUGUGCCUAUACG-3” were synthesized by GenScript by adding the Cas12a scaffold sequence (5-UAAUUUCUACUCUUGUAGAU-3 ...
-
bioRxiv - Immunology 2021Quote: ... Antigens included recombinant SARS-CoV−2 RBD protein obtained from the Saphire laboratory at LJI or recombinant nucleocapsid protein (GenScript Z03488). The next day ...
-
bioRxiv - Microbiology 2021Quote: Codon-optimized full-length open reading frames of the S genes of SARS-COV-2 variants were cloned into pcDNA3.1(+) or pVRC8400 by GenScript (Piscataway, NJ). The spikes of variants used in this study were listed in Table 1 ...
-
bioRxiv - Microbiology 2021Quote: ... of SARS-CoV-2 spike protein to Angiotensin Converting Enzyme (ACE2) was assessed via the Surrogate Virus Neutralization Test (GenScript# L00847) using the included kit protocol modified per the following ...
-
bioRxiv - Microbiology 2020Quote: ... Target proteins were obtained with purity >85% and endotoxin level <2 EU/mg (LAL Endotoxin Assay Kit, GenScript, Cat. No. L00350). In addition ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Plasmid pcDNA3-PLpro-flipGFP-T2A-mCherry was constructed from pcDNA3-TEV-flipGFP-T2A-mCherry.15 SARS-CoV-2 PLpro expression plasmid pcDNA3.1-SARS2 PLpro was ordered from Genscript (Piscataway NJ) with codon optimization ...
-
bioRxiv - Immunology 2022Quote: ... were coated overnight with 250 ng/well of purified recombinant Coronavirus proteins and 500 ng/well of a SARS-CoV-2 fusion sequence-containing peptide (KRSFIEDLLFNKVTLADAGFIK, GenScript Biotech). After washings with 0.05% Tween 20-PBS (washing buffer) ...
-
bioRxiv - Biophysics 2020Quote: SARS CoV-2 main protease (Mpro or 3CL) gene from strain BetaCoV/Wuhan/WIV04/2019 was ordered from GenScript (Piscataway, NJ) in the pET29a(+ ...
-
bioRxiv - Immunology 2021Quote: Antibodies inhibiting virus binding to host cell was measured using a commercial RBD-human angiotensin-converting enzyme 2 (hACE2) binding inhibition assay called cPASS™ (GenScript). As per manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: A 96-well plate was coated overnight at 4ºC with 100 µL of a recombinant human ACE-2 fused to a Fc fragment (GenScript Laboratories, USA) at 1 µg/mL in carbonate buffer (pH 9.6) ...
-
bioRxiv - Microbiology 2021Quote: ... of SARS-CoV-2 spike protein to Angiotensin Converting Enzyme (ACE2) was assessed via the Surrogate Virus Neutralization Test (GenScript# L00847) using the included kit protocol modified per the following ...
-
bioRxiv - Microbiology 2021Quote: Codon-optimized full-length S genes of SARS-COV-2 variants (using D614G as the base plasmid) were cloned into pCDNA3.1(+) (GenScript, Piscataway, NJ). The HIV gag/pol (pCMVΔR8.2 ...
-
bioRxiv - Immunology 2023Quote: ... DNA template containing loxP sites flanking exon 2 of the Sparcl1 “loxP-Sparcl1_Ex2-loxP” was synthesized by Genscript (Genscript Biotech Corp.) and purified ...
-
bioRxiv - Molecular Biology 2023Quote: ... or its mutants with codon optimization in Escherichia coli species were synthesized and cloned into the pGEX-6P-2 vector (GenScript, Nanjing). The resulting plasmid was transformed into BL21(DE3 ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA fragments with wild type or mutation MTB DNA sequences were synthesized and cloned into pUC19 plasmid by GenScript (Figure 2). Concentrations of these plasmids are quantified by Bio-Rad ddPCR platform following the user guide ...
-
bioRxiv - Immunology 2022Quote: ... We designed an S gene of SARS-CoV-2 with some modifications described below and synthesized it from GenScript (Piscataway, NJ). The S protein precursor has two well-defined cleavage sites ...
-
bioRxiv - Biochemistry 2020Quote: ... Rpc5-WH3/4 and Rpc5-WH1/4 from its genomic DNA (Genscript). The constructs were subsequently cloned into pOPINF or pOPINJ plasmids for bacterial expression or into pACEBac1 plasmid for baculovirus–insect cells expression ...
-
bioRxiv - Biochemistry 2024Quote: ... fused via a flexible (Thr-Gly-Ser)9 linker to the C- terminal tail region encompassing the autoinhibitory IAK motif (residues 912-935) was purchased from Genscript and subcloned between the NdeI/XhoI sites of a pET28 vector (Novagen) ...
-
bioRxiv - Biochemistry 2021Quote: ... the MERS-S gene in the antigenomic plasmid pVSV*ΔG(MERS-S) was replaced by a modified SARS-CoV-2 spike gene (Genscript, Piscattaway, USA) taking advantage of the flanking MluI and BstEII endonuclease restriction sites ...
-
bioRxiv - Immunology 2021Quote: The cDNA of membrane glyco-protein (MGP) and Non-structure protein 13 (NSP13) of ORF1b from SARS-CoV-2 were purchased from Genscript (NJ, USA) and cloned into lentiviral vector pLVX (TAKARA ...
-
bioRxiv - Immunology 2021Quote: The cDNA of membrane glyco-protein (MGP) and Non-structure protein 13 (NSP13) of ORF1b from SARS-CoV-2 were purchased from Genscript (NJ, USA) and cloned into lentiviral vector pLVX (TAKARA ...
-
bioRxiv - Biophysics 2022Quote: ... the coding sequence for the E protein from SARS-CoV-2 was initially codon optimized for Xenopus laevis and synthesized (GenScript, Piscataway, NJ). The gene was later modified for expression in HEK293 cells by adding a fluorescent EGFP tag ...
-
bioRxiv - Cell Biology 2022Quote: ... Coding sequence of SARS-CoV-2 S gene (GenBank: QHU36824.1) fusion with a c-terminal His tag was synthesized in vitro (Genscript, Piscataway, NJ, USA) after an optimization for expression in human cells.16 The sequence was cloned into a pcDNA3.1 vector to obtain pcDNA-Spike.16
-
bioRxiv - Molecular Biology 2021Quote: The surrogate virus neutralization test (sVNT) assay was performed using the SARS-CoV-2 surrogate virus neutralization test kit (GenScript, NJ, USA). Briefly ...
-
bioRxiv - Pathology 2020Quote: ... Coding sequence of SARS-CoV-2 S gene (GenBank: QHU36824.1) fusion with a c-terminal His tag was synthesized in vitro (Genscript, Piscataway, NJ, USA) after codon optimization for expression in human cells ...
-
bioRxiv - Immunology 2021Quote: SARS-CoV-2-specific CD4+ and CD8+ T cell responses in NHP PBMCs were assessed by flow cytometry using recombinant SARS-CoV-2 S1 protein (GenScript, Nanjing, China). Briefly ...
-
bioRxiv - Molecular Biology 2021Quote: ... at 30 °C in YP medium supplemented with adenine and either 2% raffinose (inducible G1 replication system) or 2% glucose (sporadic G1 replication system) and synchronized in G1 by adding α-factor (MPIB core facility or GenScript RP01002) to a final concentration of 0.5 µg/ml for bar1Δ cells or 10 µg/ml for BAR1 cells ...
-
bioRxiv - Microbiology 2020Quote: Detection and semi-quantitation of neutralizing antibodies was determined using SARS-CoV-2 Surrogate Virus Neutralization Test Kit (Genscript, Cat. No.: L00847). Testing of sera was performed as outlined in the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Sample absorbances were compared to the neutralization curve of a commercially available anti-SARS-CoV-2 RCB monoclonal antibody (GenScript, Catalog # A02051) of known concentration to extrapolate antibody titers ...
-
bioRxiv - Immunology 2021Quote: RBD and NP end-point titers were determined using standard ELISA and plates coated with 500 ng/mL SARS-CoV-2 Spike-protein Receptor-Binding Domain (RBD) (GenScript, Piscataway NJ) or 1ug/mL SARS-CoV-2 nucleocapsid protein (NP) ...
-
bioRxiv - Immunology 2021Quote: ... Gene encoding Spike of SARS-CoV-2 (GenBank NC_0101080) codon-optimized for human codon usage (GenBank MC_0101081) was purchased from Genscript (pUC57-2019-nCoV-S). RBD was used to generate a fragment encoding RBD-SSGGASVLA linker-recombinant ferritin ...
-
bioRxiv - Immunology 2020Quote: ... derived from a peptide scan [15-mers with 11 amino acid overlap] through Spike glycoprotein of SARS-CoV-2) (JPT, Cat: PM-WCPV-5 or GenScript, Cat: RP30020). Phorbol Myristate Acetate (PMA ...
-
bioRxiv - Immunology 2021Quote: RBD end-point titers were determined using standard ELISA and plates were coated with 500 ng/mL SARS-CoV-2 Spike-protein Receptor-Binding Domain (RBD) (GenScript, Piscataway NJ) Heat inactivated plasma (1:50 in blocking buffer ...
-
bioRxiv - Immunology 2022Quote: ... and 1-3 x 105 cells were stimulated for 24-48 hours with 11 SARS-CoV-2 Spike peptide pools (17- or 18-mers with 11 amino acid overlap) (Genscript, Piscataway, NJ) at a concentration of 1μg/mL per peptide ...
-
bioRxiv - Genetics 2024Quote: ... and bam 3’UTR by Genscript, Inc (Piscataway ...
-
bioRxiv - Biochemistry 2024Quote: sfGFP-Rad51 and yBBR-Rad51 were synthesized as codon-optimized ORFs and engineered into RSF-Duet1 plasmids (Supplementary Figure 9; Genscript Inc.). The sfGFP-Rad51 construct was designed as described29 and the sfGFP was engineered with flanking 16 aa linkers at the 55th amino acid of the Rad51 coding region ...
-
bioRxiv - Microbiology 2021Quote: ... Wildtype 3’UTR and 3’UTR coding sequences containing all 16 editing mutations were synthesized commercially (Genscript). Forward primers were designed to add the T7 promoter gactcgtaatacgactcactataggggaagag at the 5’ end ...
-
bioRxiv - Cell Biology 2023Quote: ... The 14-3-3 permanent bind forms of Hdac4 fragments of Hdac4-3R18 were synthesized by Genscript. The shRNA lentivirus vector for 14-3-3 isoforms ...
-
bioRxiv - Immunology 2022Quote: 15-mer peptides overlapping by 10 amino acids spanning the entire protein sequence of SARS-CoV-2 Spike were synthesized (GenScript; see Table S1). To stimulate whole blood or PBMC ...
-
bioRxiv - Pathology 2021Quote: ... the recombinant N protein was constructed by inserting the N gene of SARS-CoV-2 into the pGEX-6P vector (GenScript Japan, Tokyo, Japan). Next ...
-
bioRxiv - Immunology 2021Quote: SARS-CoV-2-specific T cell responses in rhesus macaque PBMCs were assessed by an IFN-γ ELISPOT assay using recombinant SARS-CoV-2 S1 protein (GenScript, Nanjing, China). Ninety-six-well plates (Millipore ...
-
bioRxiv - Immunology 2021Quote: ... The gene encoding the Spike protein of SARS-CoV-2 (UniProt P0DTC2) codon-optimized for expression in CHO cells was synthesized by Genscript (Piscataway, NJ, USA). The optimized DNA fragment was cloned in the expression vector to create pCNeoMEM-S ...