Labshake search
Citations for GenScript :
751 - 800 of 1071 citations for Human Protein N terminal asparagine amidohydrolase NTAN1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: A 96-well plate was coated overnight at 4ºC with 100 µL of a recombinant human ACE-2 fused to a Fc fragment (GenScript Laboratories, USA) at 1 µg/mL in carbonate buffer (pH 9.6) ...
-
bioRxiv - Biochemistry 2022Quote: ... The gene sequences for the PDZ domain of human PDLIM7 (1-84) and various point mutants were synthesised as codon optimised constructs and cloned into pET30b(+) by Genscript (USA) for bacterial expression with an N-terminal 6His-tag.
-
bioRxiv - Genetics 2022Quote: ... PRDM9 (aa 1-416) and PRDM9dC (aa 1-371) were amplified from human cDNA purchased from GenScript (ORF Clone ID OHu03253). SETD2 (aa 1450-1645 ...
-
bioRxiv - Cell Biology 2024Quote: ... The human LEP mRNA sequence was sourced from the cDNA construct hLEP-pcDNA3.1(+)-C-(K)DYK (GenScript, clone ID OHu27387; NM_000230.3). Leptin-SBP-HaloTag plasmid was generated by inserting the WT LEP gene into the backbone derived from pMPx92 using restriction digest and Gibson assembly ...
-
bioRxiv - Immunology 2022Quote: The cPass™ kit (GenScript) was used according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... ToxinSensorTM Single Test Kit (GenScript) was applied to verify that the endotoxin levels of the labeled nanoparticle were below 50 EU/kg per dose.
-
bioRxiv - Biochemistry 2020Quote: ... of SARS-CoV-2 and the ectodomain of human angiotensin converting enzyme 2 (ACE2; residue 1-615) were synthesized by GenScript (Piscataway, NJ). The S gene was fused with a C-terminal twin Strep tag [(GGGGS)2WSHPQFEK(GGGGS)2WSHPQFEK)] and cloned into a mammalian cell expression vector pCMV-IRES-puro (Codex BioSolutions ...
-
bioRxiv - Biochemistry 2020Quote: ... of SARS-CoV-2 (D614) and the ectodomain of human angiotensin converting enzyme 2 (ACE2; residue 1-615) were synthesized by GenScript (Piscataway, NJ). The S gene was fused with a C-terminal twin Strep tag [(GGGGS)2WSHPQFEK(GGGGS)2WSHPQFEK)] and cloned into a mammalian cell expression vector pCMV-IRES-puro (Codex BioSolutions ...
-
bioRxiv - Biochemistry 2020Quote: ... DNA polynucleotides encoding the transmembrane domains showing homology to previously known ACRs optimized for human codon usage were synthesized (GenScript, Piscataway, NJ) and cloned into the mammalian expression vector pcDNA3.1 (Life Technologies ...
-
bioRxiv - Immunology 2021Quote: ... Gene encoding Spike of SARS-CoV-2 (GenBank NC_0101080) codon-optimized for human codon usage (GenBank MC_0101081) was purchased from Genscript (pUC57-2019-nCoV-S). RBD was used to generate a fragment encoding RBD-SSGGASVLA linker-recombinant ferritin ...
-
bioRxiv - Synthetic Biology 2023Quote: ... with 50 nM human HER2:AF647 (Acro Biosystems) and 30 nM anti-VHH probe (MonoRab anti-Camelid VHH [iFluor 488], GenScript cat #A01862). The SARS-CoV-2 VHH strains were resuspended in saponin based stain buffer (1x PBS ...
-
bioRxiv - Biophysics 2020Quote: The cDNA sequences for the protein variants used in the study were purchased from GenScript and the proteins were N-terminally tagged with a 6xHis-Lipo domain ...
-
bioRxiv - Immunology 2021Quote: ... GST-tagged NSUN2 proteins were purified by affinity chromatography using reduced glutathione resin (GenScript, L00206) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... The sonicated DNA-Protein complexes were immunoprecipitated with the following antibodies: control IgG (A01008, GenScript), anti-TFAP2C (sc-12762 ...
-
bioRxiv - Microbiology 2019Quote: ... The blot was washed and secondary antibody (for Ryp proteins: Goat α-rabbit HRP (GenScript) 1:1,000 ...
-
bioRxiv - Biochemistry 2021Quote: Codon-optimized open reading frames for EuRe and BoMoC RT proteins were ordered from GenScript. Proteins were produced in Escherichia coli by expression from MacroLab vector 2bct with a C-terminal 6xHis tag (https://qb3.berkeley.edu/facility/qb3-macrolab/#facility-about ...
-
bioRxiv - Microbiology 2021Quote: Polyclonal Rabbit antibodies against the potential S-Layer protein of A_DKE were generated by GenScript Biotech B ...
-
bioRxiv - Neuroscience 2020Quote: ... SARS-CoV2 Spike protein (100 nM, S1 domain aa16-685, Cat# Z03485, Genscript, Piscataway, NJ), EG00229 (Cat#6986 ...
-
bioRxiv - Plant Biology 2021Quote: ... Accumulation of FHT-HA protein was assayed by immunoblot with a monoclonal HA antibody (GenScript).
-
bioRxiv - Microbiology 2020Quote: ... The expression of each anti-HIV-1 CAR was detected by protein L-biotin (GenScript) and Alexa488-conjugated anti-human Fc antibody or APC-conjugated anti-human Fc antibody as described elsewhere [78] ...
-
bioRxiv - Cell Biology 2020Quote: Our RAD-51 antibody was generated from a His-tagged fusion protein expressed by Genscript from plasmid pET30a containing the entire RAD-51S coding sequence (1385 bp ...
-
bioRxiv - Biochemistry 2021Quote: ... 15 μg total protein was loaded and resolved on Bis-Tris 4-12% gels (GenScript) and transferred to a polyvinylidene difluoride (PVDF ...
-
bioRxiv - Immunology 2022Quote: ... vaccines consisted of either SARS-CoV-2 Spike RBD WH-01 protein (GenScript; cat# Z03483) or SARS-CoV-2 WH-01 Spike protein (Acro Biosystems ...
-
bioRxiv - Microbiology 2021Quote: Microtiter plates (96-well; Thermo) were coated with 1 μg/mL S-2P protein (Genscript) corresponding to the S protein of the Wuhan-Hu-1 virus ...
-
bioRxiv - Molecular Biology 2021Quote: ... the supernatant containing the target proteins was loaded onto anti-FLAG G1 affinity resin (Genscript). The resin was washed using buffer A (20 mM Tris ...
-
bioRxiv - Microbiology 2021Quote: LAD2 cells (3×105) were incubated with Spike-RBD protein (5 μg/mL, Genscript, Z03483) in adherent buffer (1mM CaCl2 ...
-
Bacterial killing by complement requires direct anchoring of Membrane Attack Complex precursor C5b-7bioRxiv - Immunology 2019Quote: ... 50 µM of LPETG-His tagged protein was incubated with 1 mM GGG-azide (Genscript) and 25 µM His-tagged sortase-A7+ (recombinantly expressed in E ...
-
bioRxiv - Immunology 2021Quote: ... The lysate was immunoprecipitated using designated primary antibodies with protein G resin (GenScript, Piscataway, NJ), or anti-Flag M2 affinity agarose gel at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... The SECphi4 56aa protein of unknown function was the only gene not synthesized by Genscript Corp ...
-
bioRxiv - Plant Biology 2022Quote: ... samples were run on a 4%-20% gradient protein gels (GenScript, SurePAGE, Cat. No. M00655) and stained with Fast Silver Stain Kit (Beyotime ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmids expressing the PABPN1- Flag (NM_004643) and THOC5-HA (NM_001002878.1) proteins were purchased from GenScript. Plasmid pcDNA-THOC1-HA was generated by cloning the THOC1 sequence from plasmid phHpr1-GST (Addgene #11200 ...
-
bioRxiv - Molecular Biology 2023Quote: ... whereas all other gels were stained using the eStain™ L1 protein staining system (GenScript). Precision Plus Protein™ standards (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2023Quote: ... Equal amounts of protein lysates were loaded onto SurePAGE Bis-Tris 4-20% gels (Genscript) and transferred either to
-
bioRxiv - Microbiology 2023Quote: ... or 9 ug/mL of full-length FimH protein (antigen for custom antibody production, Genscript) was used.
-
bioRxiv - Genetics 2023Quote: ... The protein samples were separated by SDS-PAGE (4-12% Bis-Tris gels, Genscript, #M41210C) with MOPS buffer (Tris-MOPS-SDS Running Buffer ...
-
bioRxiv - Cancer Biology 2023Quote: ... Protein coding sequences for PRMT1v1 (ENST00000391851.8) and PRMT1v2 (ENST00000454376.7) were ordered from GenScript (https://www.genscript.com) and PCR-cloned into pHIV-Luc-ZsGreen (Addgene plasmid #39196 ...
-
bioRxiv - Microbiology 2023Quote: ... the purified polyclonal antibodies against RNase E was bound to Protein A/G MagBeads (Genscript), followed by cross-linking using dimethyl pimelidate dihydrochloride (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2023Quote: ... Sup35NM was visualized using an antibody raised against residue 125-253 of the protein(GenScript). Cell lysates were fractionated by SDS-PAGE ...
-
bioRxiv - Microbiology 2023Quote: ... enterica Tsr LBD construct for recombinant protein expression was performed as a service by Genscript Biotech Corp ...
-
bioRxiv - Cancer Biology 2024Quote: ... The expression of the CAR was detected using a biotinylated protein L (GenScript, Piscataway, NJ) antibody and streptavidin-coupled PE (BD Biosciences ...
-
bioRxiv - Bioengineering 2024Quote: PEG hydrogels were functionalized with the following peptides and proteins purchased from Genscript (Piscataway, NJ): RGDS ...
-
bioRxiv - Immunology 2021Quote: ... ToxinSensor™ Single Test Kit (GenScript) was applied to verify that the endotoxin levels of the nanoparticle sample were below 50 EU/kg per dose.
-
bioRxiv - Neuroscience 2021Quote: ... using a GenBuilder cloning kit (GenScript). pCS2HA-NPHP1 and pCS2HA-NPHP1 Δ(49-110 ...
-
bioRxiv - Molecular Biology 2024Quote: ... using a GenBuilder Cloning kit (GenScript). Reporter loxP-2272 was generated by substituting the lox17:N site (ATAACTTCGTATAGTATACCTTATAGCAATTTAT ...
-
bioRxiv - Cell Biology 2021Quote: ... All SHIP164 (UHRF1BP1L) ORFs used in this study utilized a human codon optimized sequence designed and purchased from Genscript (sequence available upon request). The following constructs were kind gifts ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... 1 μg of POR-WT and mutant membrane proteins were separated on an SDS-PAGE gel and blotted on to polyvinyl difluoride (PVDF) membranes to probe with a rabbit polyclonal antibody against wild-type human POR from Genscript (Genscript, NJ, USA) as described previously [43] ...
-
bioRxiv - Immunology 2020Quote: ... was added to the wells and incubated at room temperature for 2 hours and the binding was detected by adding 100 μL 1:10,000 diluted HRP conjugated anti-human IgG antibodies (GenScript, Piscataway, USA; Cat# A00166) with a 1-hour incubation period at room temperature ...
-
bioRxiv - Biochemistry 2021Quote: ... Samples were next incubated under constant agitation with 10% (v/v) Protein-A-Sepharose beads (Genscript) for a further 2 h at 4°C before recovery by centrifugation at 13,000 g for 1 min ...
-
bioRxiv - Immunology 2021Quote: ... chimeric group 1 or group 2 stalk proteins expressed in Sf9 cells were column purified (GenScript). For functional assays and luminex Fc receptor binding and titer ...
-
bioRxiv - Microbiology 2021Quote: Plasmids encoding cDNA for hMPV 130-BV F and hMPV B2 F proteins were synthesized (GenScript) and cloned into the pcDNA3.1+ vector as previously described (29 ...