Labshake search
Citations for GenScript :
751 - 800 of 925 citations for Human Mesoderm Specific Transcript Homolog Protein MEST ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: The HTP-3 antibody used in this study was generated from an identical C-terminal segment of the HTP-3 protein (synthesized by GenScript) as was used by (MacQueen et al ...
-
bioRxiv - Immunology 2022Quote: ... for 30 minutes before adding 100 ng/mL of Sars-CoV-2 spike protein (RBD, HisTag) (Cat. ZO3483-1-GenScript) or infected using Heat-inactivated SARS-CoV-2 (VR-1986HK ...
-
bioRxiv - Immunology 2022Quote: The variants of concern of SARS-CoV-2 spike protein genes were optimized using mammalian codon and synthesized by Genscript, then cloned into pcDNA3.1(+ ...
-
bioRxiv - Microbiology 2021Quote: ... Specific anti-CoV immunoreactivity was detected using an in-house SARS-CoV-2 nucleocapsid protein (U864YFA140-4/CB2093) rabbit antibody (Genscript) at a 1:1000 dilution ...
-
bioRxiv - Immunology 2021Quote: ... 15-mer peptides with 11 amino acids overlap that cover the full length of S protein of SARS-CoV-2 were individually synthesized (GenScript). Peptides were dissolved in DMSO at 12 mg each peptide/ml and 8-12 peptides were mixed to create 75 different semi-pools so that the responsible epitopes can be determined from the reactivities of horizontal and vertical pools ...
-
bioRxiv - Immunology 2020Quote: ... 1mL of day 56 serum was diluted to 10 mL with PBS and incubated with 1 mL of 3x PBS washed protein A beads (GenScript) with agitation overnight at 37°C ...
-
bioRxiv - Microbiology 2019Quote: ... the protein sequence was analyzed for multiple features such as antigenicity and hydrophobicity by the antibody manufacturer (GenScript, Piscataway, NJ), using the OptimumAntigen™ Design Tool (https://www.genscript.com/antigen-design.html) ...
-
bioRxiv - Immunology 2020Quote: The SARS-CoV-2 pseudovirus was produced by co-transfection of HEK293T cells with 1:1 ratio of DNA plasmid encoding SARS-CoV-2 S protein (GenScript) and backbone plasmid pNL4-3.Luc.R-E-(NIH AIDS Reagent ...
-
bioRxiv - Immunology 2021Quote: ... for >1 hour at ambient temperature then incubated with *** μg / protein gel of MonoRab anti-his tag C-term (Genscript) in Intercept T20 (PBS ...
-
bioRxiv - Immunology 2021Quote: ... cDNAs for these proteins and the mutated versions of Cda2 (Cda2-M1 and Cda2-M2) were synthesized and cloned in pET19b (GenScript) so that the vector-encoded His tag was integrated with the N-terminus of the cDNA ...
-
bioRxiv - Immunology 2021Quote: ... This recombinant target panel consisted of two full-length viral structural proteins, S (FL, trimer-stabilized, LakePharma) and N (GenScript); two truncated S protein domains ...
-
bioRxiv - Immunology 2020Quote: ... Cells were cultured at 5e5 cells/well with two peptide pools representing the full-length S protein at 1 μg/ml (Genscript) overnight in order to stimulate the cells ...
-
bioRxiv - Immunology 2020Quote: ... Peptide pools consisted of 15-mer peptides overlapping by 11 amino acids and spanned the entire SARS-CoV-2 S protein (GenScript). After stimulation ...
-
bioRxiv - Microbiology 2020Quote: ... the fixed cells were labeled with primary antibodies including goat anti-major outer-membrane protein (MOMP; Meridian, Memphis, TN) and mouse or rabbit anti-six histidine tag (Genscript, Nanjing ...
-
bioRxiv - Molecular Biology 2022Quote: ... The genes for the designed HN protein variant 1 (HNv1) and F protein variant 1 (Fv1) were codon-optimized for expression in SJ and synthesized by Genscript® ...
-
bioRxiv - Immunology 2022Quote: ... The recombinant monoclonal antibodies of IgG subtypes were purified after incubation of filtered Expi293F cell supernatant with Protein G resin beads (GenScript) at 4°C overnight ...
-
bioRxiv - Immunology 2022Quote: ... for 30 minutes before being exposed with 100 ng/mL of Sars-CoV-2 spike protein (RBD, HisTag) (Cat. ZO3483-1-GenScript) at different times (5 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and AALA mutant were produced as GST-fused proteins by cloning the encoding ORF sequences into the pGEX-6P-1 plasmid (GenScript).
-
bioRxiv - Biochemistry 2024Quote: ... gene was codon-optimized and cloned into the p423_GAL1 yeast expression vector as an N-terminal Flag (DYKDDDDK) and C-terminal deca-histidine (10X His) tagged fusion protein (GenScript) (Supplementary Fig ...
-
bioRxiv - Neuroscience 2023Quote: ... stephanieae’s transcriptome for the bioactive ELH peptide was translated into a predicted protein and synthesized by Genscript (Piscataway, NJ, USA) to 95 % purity ...
-
bioRxiv - Cell Biology 2023Quote: ... 15-30 μg protein were loaded and separated by SDS-PAGE in 4–12% SurePAGE 12-well pre-cast gels (Genscript). Proteins were transferred onto PVDF membranes using iBlot or iBlot2 system (Thermo) ...
-
bioRxiv - Microbiology 2023Quote: ... The number and size of cleavage products were assessed by visualization of protein bands on 8-16% SurePAGE precast gels (GenScript) using MES SDS running buffer (GenScript ...
-
bioRxiv - Molecular Biology 2023Quote: We chose gene fragments encoding complete deaminase domains as well as extra N and C protein sequences for commercial synthesis (GenScript) (fig ...
-
bioRxiv - Plant Biology 2023Quote: ... Colonies exhibiting VENUS fluorescence and an AphVII cassette knock-in at the CAS9 target site were examined for accumulation of the CreTPT3 protein by immunodetection using CreTPT3 antibodies generated by GenScript USA Inc (Piscataway ...
-
bioRxiv - Microbiology 2023Quote: ... The gene encoding the phage CARD-only protein (pCARD) from Acinetobacter phage 133 (IMG gene accession 651703305) was synthesized and cloned by Genscript Corp ...
-
bioRxiv - Developmental Biology 2023Quote: ... 0.25% DMSO) (refer to Fig. 1C) in the presence or absence of SARS-CoV-2 spike protein (5ng/mL; GenScript). Controls were kept in the treatment solution with only DMSO ...
-
bioRxiv - Molecular Biology 2023Quote: The DNA sequences of all smORF proteins were synthesized and subcloned into a modified pRSET vector by GenScript (Hong Kong). The construct was tailored to have an N-terminal hexa-histidine-tagged lipoyl fusion protein followed by a thrombin cleavage site and the respective smORF protein ...
-
bioRxiv - Immunology 2023Quote: ... backbone and cDNA sequences for human NINJ1 (UniProtKB Q92982) or NINJ2 (UniProtKB Q9NZG7) protein with an N-terminal 3xFLAG tag and GSG linker were ordered from Genscript. For protein expression ...
-
bioRxiv - Biophysics 2023Quote: The binding affinities of wild-type Clr6S and Rpd3S proteins to the synthesized H3K36me3 peptide (ATKAARKSAPATGGVK36(me3)KPHRYRPG) (GenScript Biotech) were determined using BIAcore T200 system (GE Healthcare ...
-
bioRxiv - Cell Biology 2023Quote: ... 20-30ug of total protein per sample was loaded into wells of 4-12% Bis-Tris gels (Genscript or Invitrogen) and separated in MES or MOPS buffer ran at 65v for 30 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... The beads were washed with TAP-wash buffer and proteins were eluted using HA peptide (200 μg/ml; GenScript, RP11735) by shaking the beads in thermomixer at 1400 rpm for 45 min at 30 °C ...
-
bioRxiv - Developmental Biology 2024Quote: The antibodies used in this study were as follows: A custom antibody against ExoA was generated in rabbits using purified full-length protein as the antigen (GenScript). Mouse Polyglycylated-tubulin antibody (1:1000 ...
-
bioRxiv - Biophysics 2024Quote: Antibodies were obtained from the following sources: Protein C-Tag Antibody (HPC4) (Rabbit polyclonal) was from Genscript (Piscataway, NJ, USA); Anti-Phosphotyrosine Antibody ...
-
bioRxiv - Molecular Biology 2024Quote: ... [32] Protein purity was confirmed by sodium-dodecyl-sulfate polyacrylamide electrophoresis (SDS-PAGE) on 4-15% gradient gels (Genscript, USA) stained with 0.0025% w/v each of Coomassie® Brilliant Blue G-250 and R-250 in 10% v/v ethanol ...
-
bioRxiv - Biochemistry 2024Quote: ... and a synthetically added sequence for the Small Ubiquitin-like Modifier (SUMO) protein (Uniprot ID Q12306) was commercially appended (GenScript). The entire sequence was then subcloned into the pET-45b(+ ...
-
bioRxiv - Immunology 2024Quote: 15-mer peptides with 11 amino acids overlap that cover the full length of S protein of SARS-CoV-2 were synthesized (GenScript). Peptides were dissolved in DMSO at 12 mg/ml and 12-15 peptides were mixed to create 26 different semi-pools ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... rosetta synaptobrevin a codon-optimised nucleotide sequence encoding the soluble portion of the protein [Syb (1-75)] was prepared by gene synthesis (Genscript, USA): GAGGCGAACCGTACCGGTGACTACCGTCTGCAGGAAGCGCAGCGTCAAGTGGGCGAAGTT CAAAACGTGATGCGTGATAACCTGACCAAGGTTATCGAGCGTGGTGAAAAACTGGACGATC TGGACGCGAAGGCGGAAGATCTGGAGGCGGAGGGTCAGCGTTTCCAAAACCGTGCGGGCC GTCTGCGTCGTCAGATGTGGTGGCAAAACAAACGTAACCAGTAA
-
bioRxiv - Developmental Biology 2022Quote: ... The protein was eluted using elution buffer (50mM Tris-HCL,7.4, 100mM NaCl, 1mM EGTA, Flag peptide (GenScript, 300 μg/ml). The isolated proteins were then prepared for mass spectrometry using an in-solution protein digestion kit (Thermo Scientific) ...
-
bioRxiv - Pathology 2019Quote: ... The samples were loaded onto a 12% (vol/vol) SDS/PAGE gel and target proteins were detected using a polyclonal anti-GFP antibody (GenScript, USA) or a monoclonal anti-FLAG (Sigma ...
-
bioRxiv - Bioengineering 2021Quote: Purified RfxCas13d proteins and synthetic crRNAs were mixed (unless otherwise indicated) at 2:1 molar ratio in Buffer 1 (GenScript SC1841) or Buffer 22 (25mM Tris pH 7.5 ...
-
bioRxiv - Biochemistry 2021Quote: ... FLAG-tagged proteins were released from the resin by incubation with buffer supplemented with 50 mM FLAG peptide (Genscript, Piscataway, NJ) for 30 min.
-
bioRxiv - Microbiology 2020Quote: ... were coated overnight at 4°C with 2μg/ml of recombinant SARS-CoV-2 S1-RBD protein (GenScript No. Z03483-1) in carbonate-bicarbonate buffer (Sigma Aldrich No ...
-
bioRxiv - Microbiology 2021Quote: ... of SARS-CoV-2 spike protein to Angiotensin Converting Enzyme (ACE2) was assessed via the Surrogate Virus Neutralization Test (GenScript# L00847) using the included kit protocol modified per the following ...
-
bioRxiv - Biophysics 2020Quote: ... The identities of purified HA-TIN2S and HA-TIN2L proteins were confirmed by the Western Blot analysis using the HA antibody (GenScript A00168), and MALDI-TOF mass spectrometry analysis (UNC-Chapel Hill Proteomics Center) ...
-
bioRxiv - Cell Biology 2022Quote: ... 20-50 μg of protein lysate of each sample was loaded and separated on 4-12% Bis-Tris gels (Thermo Fisher or GenScript) according to manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... were coated overnight with 250 ng/well of purified recombinant Coronavirus proteins and 500 ng/well of a SARS-CoV-2 fusion sequence-containing peptide (KRSFIEDLLFNKVTLADAGFIK, GenScript Biotech). After washings with 0.05% Tween 20-PBS (washing buffer) ...
-
bioRxiv - Biochemistry 2022Quote: Sequences encoding the 3CL-pro and RBD proteins were codon optimized for expression in Escherichia coli and cloned into the pET-28a(+) vector (Genscript Biotech). The chimeric protein 3CLpro-RBD was produced by generating a gene construct that linked the 3CL-pro and RBD genes by a bridge sequence that encoded for glycine-proline triple repeat (GPGPGP ...
-
bioRxiv - Molecular Biology 2020Quote: ... vector containing DENV2C protein gene sequence with N-terminal His tag and Tobacco Etch Virus (TEV) digestion site was purchased from GenScript (China). Recombinant capsid protein from DENV2 NGC strain was expressed in Escherichia coli BL21 strain ...
-
bioRxiv - Microbiology 2021Quote: ... active protein fractions were further separated through sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE; 4%–20% Bis-Tris Gel; GenScript, USA). Proteins in the gel slices were eluted in HEPES-K+ buffer (50 mM ...
-
bioRxiv - Microbiology 2021Quote: ... of SARS-CoV-2 spike protein to Angiotensin Converting Enzyme (ACE2) was assessed via the Surrogate Virus Neutralization Test (GenScript# L00847) using the included kit protocol modified per the following ...