Labshake search
Citations for GenScript :
751 - 800 of 1087 citations for Carbamic acid 2 4 hexadienyl 1 1 dimethylethyl ester E E 9ci since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... The hexahistidine tag and Sso7dmut were cleaved from HIV-1 IN by addition of his-tagged sortase and GGGC peptide (GenScript). The reaction was exposed to nickel resin to remove sortase and any residual uncleaved IN ...
-
bioRxiv - Biophysics 2022Quote: ... construct cloned in a pGEX-6P-1 vector with an N terminal GST-tag followed by a precision protease site was obtained from GenScript.
-
bioRxiv - Pharmacology and Toxicology 2024Quote: nLucWT/K0-RIPK1KD (kinase domain 1-324) fusion gene with a 24-residue flexible linker in between (SGGRSSGSGSTSGSGTSLYRRVGT) was synthesized and codon optimized by GenScript and cloned into pcDNA3.1 backbone ...
-
bioRxiv - Microbiology 2024Quote: ... A 100 µL (1:20,000 dilution) of Mouse Anti-Rabbit IgG Fc monoclonal antibody (mAb, 14H9H10) conjugated with HRP (GenScript # A01856) was added to each well and incubated at 37 °C for 30 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... The gel content was transferred onto a 0.2 μm nitrocellulose membrane and incubated it with a primary antibody (1:1000) targeting the C-terminal region of the wild-type TTR sequence from GenScript. The secondary antibody was horseradish peroxidase-conjugated goat anti-rabbit IgG (dilution 1:1000 ...
-
bioRxiv - Microbiology 2024Quote: ... The best performing monoclonal antibody ‘A11-1’ was chosen for DNA sequencing (see supplementary material) and recombinant antibody production by Genscript Biotech.
-
bioRxiv - Biophysics 2024Quote: ... followed by probing with a primary antibody (diluted 1:1000) targeting the C-terminal region of the wild type TTR sequence (GenScript). Horseradish peroxidase-conjugated goat anti-rabbit IgG (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... AA 1-154) of Aquifex aeolicus were fused by a Gly-Ser linker and constructed in a pUC57 plasmid by GenScript USA ...
-
bioRxiv - Molecular Biology 2024Quote: ... was identified by transferring the gel contents onto a 0.2 μm nitrocellulose membrane and probing it with a primary antibody (1:1000) targeting the C-terminal region of the wild-type TTR sequence from GenScript. A secondary antibody ...
-
bioRxiv - Cancer Biology 2024Quote: ... miR-19a and the NTC sequences were encoded into the pre-miR-30-based short hairpin cassette flanked with MLU-1 restriction (GenScript). Both miRNA-encoding plasmids and MG1 shuttle plasmids were digested using MLU-1 (NEB ...
-
bioRxiv - Biophysics 2024Quote: ... and deletion of residues 1-20 (mj-120, with Met1 at position 20) were encoded into the pET21a(+) vector (Genscript). Protein expression constructs used in this study did not include solubility or purification tags ...
-
bioRxiv - Cell Biology 2024Quote: ... the cytosol-exposed domain of CCPG1 (1-212aa) fused to a C-terminal GST-tag was gene synthesized by Genscript and cloned into a pET-DUET1 vector ...
-
bioRxiv - Cell Biology 2024Quote: ... the cytosol-exposed domain of FKBP8 (1-391aa) fused to a C-terminal GST-tag was gene synthesized by Genscript and cloned into a pET-DUET1 vector ...
-
bioRxiv - Cell Biology 2024Quote: ... was established from screening hybridomas generated from mice immunized with purified N-terminus of mouse CATSPER1 (1-150 aa; GenScript) followed by Protein G affinity purification.
-
bioRxiv - Biochemistry 2024Quote: Genes encoding Ndas1146 (Uniprot: D7B1W6) and Ndas1147 (Uniprot: D7B1W7) from Nocardiopsis dassonvillei were cloned into a pRSFDuet-1 vector by Genscript. Before further use ...
-
bioRxiv - Cell Biology 2024Quote: The Golgin84-HA-OMP DNA construct contains human GOLGA5 (residues 1-698) fused with HA epitope and C-terminal transmembrane domain of OMP25 (aa 110-145) was synthesized by GenScript and subcloned into pcDNA3.1 ...
-
bioRxiv - Microbiology 2020Quote: ... Antibody against nucleocapsid protein of anti-SARS-CoV-2 N protein (Genscript, USA) and GAPDH of anti-GAPDH (Proteintech ...
-
bioRxiv - Immunology 2020Quote: The SARS-CoV-2 RBD (BEI NR-52422) construct was synthesized by GenScript into pcDNA3.1-with an N-terminal mu-phosphatase signal peptide and a C-terminal octa-histidine tag (GHHHHHHHH) ...
-
bioRxiv - Biophysics 2022Quote: ... for 2 minutes followed by 20 μM biotinylated FLAG-tag antibody (A01429, GenScript) for 30 minutes ...
-
bioRxiv - Immunology 2020Quote: DNA encoding SARS-Cov-2 RBD (residues 319-541) was gene synthesized (Genscript) and cloned into pCEP4 mammalian expression vector with a N-terminal IgG leader sequence and C-terminal Avitag and His tag ...
-
bioRxiv - Immunology 2020Quote: ... DNA encoding the SARS-Cov-2 RBD (residues 331-527) was synthesized (Genscript) with a C-terminal His6 purification tag and cloned into a CMVR plasmid ...
-
bioRxiv - Microbiology 2021Quote: The SARS-CoV-2 Surrogate Virus Neutralization Test Kit from GenScript (REF: L00847) was used according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... The plasmid encoding for SARS-CoV-2 S RBD was synthesized commercially (Genscript). The RBD sequence (encoding for residues 319-541 ...
-
bioRxiv - Molecular Biology 2021Quote: The SARS-CoV-2 RBD (BEI NR-52422) construct was synthesized by GenScript into pcDNA3.1-with an N-terminal mu-phosphatase signal peptide and a C-terminal octa-histidine tag (GHHHHHHHH) ...
-
bioRxiv - Molecular Biology 2022Quote: The sequence for Rab7A (residues 2-176, uniprot P51149) was purchased from Genscript, N-terminally fused to a His tag and tobacco etch virus (TEV ...
-
Development of monoclonal antibody-based blocking ELISA for detecting SARS-CoV-2 exposure in animalsbioRxiv - Microbiology 2023Quote: ... A cPass™ SARS-CoV-2 Neutralization Antibody Detection Kit (GenScript, Piscataway, NJ) was used and the test was performed following the instructions of the manufacture ...
-
bioRxiv - Biophysics 2023Quote: ... The expression clone of ppSUMO-2_SARS-CoV-2 NSP16 was obtained from Genscript. Expression was carried out in E ...
-
bioRxiv - Microbiology 2023Quote: Full-length SARS-CoV-2 S gene (GenBank: NC_045512.2) was synthesized by Genscript. as human codon-optimized cDNAs ...
-
bioRxiv - Immunology 2022Quote: ... The SARS-CoV-2 spike glycoprotein expression constructs were synthesized by GenScript (Netherlands). Constructs bore the following mutations relative to the Wuhan-Hu-1 sequence (GenBank ...
-
bioRxiv - Immunology 2022Quote: ... or 2 µg/ml ISQAVHAAHAEINEAGR MHC-II binding peptide (ovalbumin 323-339, GenScript) was added ...
-
bioRxiv - Immunology 2022Quote: DNA encoding SARS-Cov-2 RBD (residues 319-541) was gene synthesized (Genscript) and cloned into the pCEP4 mammalian expression vector (Invitrogen ...
-
bioRxiv - Neuroscience 2024Quote: ... and 2 µM the hemichannel inhibitor peptide TAT-Gap19 (YGRKKRRQRRRKQIEIKKFK, synthetized by Genscript). Slices in water were used as control for CBX and TAT Gap19 slices ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 ml of anti-His-tag affinity resin (GenScript Biotech, Piscataway, NJ, USA) was added into the concentrated culture medium and incubated at 4 °C overnight with rotation ...
-
bioRxiv - Microbiology 2022Quote: ... SDS-PAGE was performed using 30 μ l of sample with 4-20% Bis-Tris gels (Genscript) in Tris-MOPS-SDS running buffer (Genscript) ...
-
bioRxiv - Cell Biology 2020Quote: ... A total of 40 µg proteins were separated by 4-20% gradient SDS-PAGE gels (GenScript, M42015C) and transferred to PVDF membranes (Millipore ...
-
bioRxiv - Microbiology 2023Quote: ... The samples were run on precast SurePAGE gels (Bis–Tris, 10×8, 4%– 12%, 15 wells; GenScript) and transferred to polyvinylidene difluoride membranes (Beyotime Biotechnology ...
-
bioRxiv - Cancer Biology 2023Quote: ... and electrophoresed in 4-12% Express-Plus PAGE gels in Tris-MOPS (SDS) running buffer (GenScript #M00138). Proteins were transferred onto PVDF membranes ...
-
bioRxiv - Cancer Biology 2023Quote: Input and IP protein samples were separated on a 4-12% Bis-Tris protein gel (GenScript, M41215C) using Tris-MOPS running buffer and then transferred onto a PVDF membrane and blocked overnight in 3% BSA in PBST buffer (PBS + 0.1% Tween 20) ...
-
bioRxiv - Cell Biology 2024Quote: A total of about 75 ng of proteins were loaded on 4-20% acrylamide gels (GenScript, M00655) and run at 120 V for 90’ in commercial Tris-MOPS-SDS running buffer (GenScript ...
-
bioRxiv - Microbiology 2020Quote: ... the recombinant protein of the extracellular domain of human ACE2 (aa 1-740) fused to Fc (ACE2-Fc, Genscript, Nanjing, China) was coated on 96-well microtiter plate (50 ng/well ...
-
bioRxiv - Biophysics 2021Quote: ... at C-terminal was cloned into pGEX-6P-1 vector at BamHI and XhoI sites using gene synthesis and cloning services (GenScript, USA). The plasmid was transformed into E ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... rosetta synaptobrevin a codon-optimised nucleotide sequence encoding the soluble portion of the protein [Syb (1-75)] was prepared by gene synthesis (Genscript, USA): GAGGCGAACCGTACCGGTGACTACCGTCTGCAGGAAGCGCAGCGTCAAGTGGGCGAAGTT CAAAACGTGATGCGTGATAACCTGACCAAGGTTATCGAGCGTGGTGAAAAACTGGACGATC TGGACGCGAAGGCGGAAGATCTGGAGGCGGAGGGTCAGCGTTTCCAAAACCGTGCGGGCC GTCTGCGTCGTCAGATGTGGTGGCAAAACAAACGTAACCAGTAA
-
bioRxiv - Cell Biology 2020Quote: ... consensus sequence was obtained from RepeatMasker and/or from repbase (http://www.repeatmasker.org/) synthetized and cloned into pUC57 by GenScript (Supplementary Table 1). To make the IAPEz reporter (pTCH1) ...
-
bioRxiv - Cell Biology 2021Quote: ... were transfected with individual shRNA in pLKO.1 (Broad Institute, Cambridge, MA) mixed with packaging plasmid pCMV-dR8.91 (G193486, GenScript, Piscataway, NJ) and envelope plasmid pVSV-G (G178153 ...
-
bioRxiv - Immunology 2021Quote: ... and beta (1-244) chains were synthesized and cloned into the bacterial expression vector pET30a via NdeI and XhoI (Genscript, USA). Proteins were expressed as inclusion bodies in BL21 (DE3 ...
-
bioRxiv - Cell Biology 2020Quote: ... and for generation of EGFP-C2-Arp3B plasmid, the mRNA transcript variant 1 encoding murine actin-related protein 3B (Actr3b) (Jay et al., 2000) was synthesized (GenScript Biotech) and cloned into pEGFP-C2 vector (Clontech).
-
bioRxiv - Immunology 2021Quote: ... The wells were washed six times with PBS-T and incubated with 100 µL (1:10000) of Goat Anti Mouse IgG (Genscript, USA) or Anti Hamster IgG (Abcam ...
-
bioRxiv - Plant Biology 2020Quote: ... 1.5 μg of MEA or 1.5 μg of CLF (PRC2) complexes were incubated with 1 μg of Histone H3 peptides (GenScript, Piscataway, NJ) and 1.5 μCi of 3H-SAM (Perkin Elmer ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Mammalian plasmid pcDNA3.1(+)-pHluorin was made by synthesizing and cloning a codon optimized sequence of pHluorin into the pcDNA3.1(+) backbone (GenScript; Piscataway, NJ).
-
bioRxiv - Immunology 2023Quote: DNA encoding for residues 24-167 of the extracellular portion of human PD-1 (UniProt Q15116) with a C-terminus histidine tag or corresponding PD-1 N58Q mutant were cloned into pcDNA3.4 by GenScript (Piscataway, NJ). Expi293 cells were transiently transfected with plasmid DNA mixed with PEI (Polysciences ...