Labshake search
Citations for GenScript :
751 - 800 of 948 citations for 6H Imidazo 4 5 1 de acridin 6 one 5 3 diethylamino propyl amino 8 hydroxy since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: We purchased the full-length human LRRK1 gene from Genscript (residues 1-2015, uniprot Q38SD2), codon optimized for Homo sapiens ...
-
bioRxiv - Microbiology 2023Quote: ... was detected by HRP-conjugated rabbit anti-camelid VHH antibodies (Genscript, A01861-200, 1/5000) or a mouse anti-HA antibody (BioLegend 901501 ...
-
bioRxiv - Microbiology 2023Quote: ... Primary antibodies for assay of transfected cells were goat polyclonal anti-HA (1:500, GenScript), and mouse monoclonal anti-FLAG (1:500 ...
-
bioRxiv - Physiology 2023Quote: ... Tyrosine-substituted (Y134A) and N-terminal (1-96 aa) truncated mutants were purchased from GenScript Biotech (Piscataway ...
-
bioRxiv - Cancer Biology 2024Quote: ... Diluted 1:5000 horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG (cat no. A00160; GenScript) and diluted 1:5000 HRP-conjugated goat anti-rabbit IgG (cat no ...
-
bioRxiv - Cell Biology 2024Quote: ... Clarified lysates were incubated with 1 mL Anti-DYKDDDDK (FLAG) Affinity Resin (Genscript; Piscataway, NJ) for 2 h at 4 °C and then washed with 10 column volumes (CVs ...
-
bioRxiv - Cancer Biology 2024Quote: ... and TTK genes were introduced in PANC-1 using pcDNA3.1+/C-(K)-DYK (GenEZ; GenScript) vectors (10 µg/ml) ...
-
bioRxiv - Biochemistry 2021Quote: ... and 1 mM DTT and incubated with magnetic glutathione beads (L00327; GenScript Biotech, Piscataway, NJ, USA) loaded with recombinant GST-tagged AF1521 for 2 to 4 hours at 4°C with rotation ...
-
bioRxiv - Immunology 2021Quote: ... chimeric group 1 or group 2 stalk proteins expressed in Sf9 cells were column purified (GenScript). For functional assays and luminex Fc receptor binding and titer ...
-
bioRxiv - Cell Biology 2022Quote: ... We used the following primary antibodies diluted in TNT buffer: anti-beta actin (1:1000, GenScript), anti-Lamin B1 (1:1000 ...
-
bioRxiv - Neuroscience 2020Quote: ... Rabbit anti-CCHa1 (Our lab raised antibodies against the peptide QIDADNENYSGYELT 68, Genscript, 1:50 dilution). Secondary antibodies used ...
-
bioRxiv - Biophysics 2022Quote: ... and pBAD33mut-LTR-III WT and pBAD33mut-PARP-1 WT vectors were synthesized and cloned (Genscript) into pBAD33mut vector using the SacI and SpeI restriction enzyme sites ...
-
bioRxiv - Genomics 2022Quote: ... Anti-Sloth1 and Anti-Sloth2 antibodies (1:1000) were raised in rabbits (Genscript, PolyExpress Silver Package).
-
bioRxiv - Plant Biology 2022Quote: ... whereas the autoubiquitination was detected by IB analysis with anti-GST (A00865-200, 1:5,000, Genscript) as primary antibody ...
-
bioRxiv - Cell Biology 2023Quote: ... rabbit anti-Akr1B-2 at 1:100,000 (produced to full-length Drosophila p23 (Q9VH95) by GenScript) and mouse anti-α-Tubulin at 1:5000 (AB_477593 ...
-
bioRxiv - Microbiology 2024Quote: ... Membrane was blotted with anti-ChmA (dilution = 1:500; custom polyclonal rabbit antibody generated by GenScript), anti-PicA (dilution = 1:1,000 ...
-
bioRxiv - Cell Biology 2024Quote: Wild-type and analog-sensitive Chk2 ORF sequences were cloned in the pGex6p-1 plasmid (Genscript, see plasmid construction section for details ...
-
bioRxiv - Molecular Biology 2021Quote: ... with 1 ug of anti-UPF1 or anti-ARS2 antibodies and protein A/G magnetic beads (Genscript). The next day ...
-
bioRxiv - Cell Biology 2022Quote: ... antibody and a custom rabbit anti-NCX1 antibody as previously described5 (1:100, Genscript Corporation, Piscataway, NJ). Secondary antibody labeling was carried out using donkey anti-mouse Alexa Fluor 647 (1:200 ...
-
bioRxiv - Biochemistry 2021Quote: All peptides (see all sequences in Supplementary Tables 1) were purchased at 95% purity (Genscript, Leiden, Netherlands). NAD was purchased from Roche (Basel ...
-
bioRxiv - Cancer Biology 2020Quote: ... the PD-L1-lnc shRNA vectors were synthesized and then cloned into pLKO.1 vector (GenScript, China). The siRNA target sequences were listed in table S3 ...
-
bioRxiv - Immunology 2022Quote: ... the following pairs of primary antibodies were used: 1) TCRα-TCRβ crosslinking: rabbit anti-c-Myc (Genscript) and mouse anti-V5 (Genscript) ...
-
bioRxiv - Biophysics 2022Quote: The C terminal domain of Influenza A Matrix protein 1 (M1C) was subcloned into pET15b vector (GenScript). In addition to the M1C sequence ...
-
bioRxiv - Biophysics 2020Quote: ... After the dialysis step we applied 1:100 stoichiometric molar ratio 3C protease (PreScission protease, GenScript, USA) to cleave the C-terminal hexa-histidine tag of construct-1 with native N- & C-terminals ...
-
bioRxiv - Plant Biology 2019Quote: ... The N-terminal part of the PKL protein (aa 1-586) was synthetized by GenScript (http://www.genscript.com). Details of the molecular cloning work are provided in the Supplementary Experimental Procedures.
-
bioRxiv - Immunology 2020Quote: ... with a plasmid containing the complete human ACE2 transcript variant 1 cDNA sequence (NM_001371415.1) cloned into the mammalian expression vector pcDNA3.1-C’ FLAG by Genscript. Cells were grown in Iscove’s Modified Dulbecco’s Medium (Sigma Aldrich ...
-
bioRxiv - Plant Biology 2019Quote: ... recovered in 2.5x volume of W5 solution and elicited with 1 µM flg22 (QRLSTGSRINSAKDDAAGLQIA; Genscript, Nanjing, China) in 1 mL W5 solution for 6 h.
-
bioRxiv - Developmental Biology 2020Quote: ... Sections were incubated with 1 µg/ml of a custom-made MMP13 rabbit polyclonal primary antibody (GenScript, Piscataway ...
-
bioRxiv - Microbiology 2021Quote: ... N501Y.V1 (Variant 1) mutant Spike proteins of SARS-CoV-2 were codon-optimized and synthesized by GenScript Inc (Nanjing ...
-
bioRxiv - Immunology 2020Quote: ... were coated in 1 carbonate buffer (0.1 M at pH 9.6) with 1.0 ug/ml S1 protein (GenScript). The plates were incubated overnight at 4°C in a humidified chamber and then blocked in PBS plus 0.05% Tween 20 (PBST ...
-
bioRxiv - Immunology 2020Quote: ... or 1-10 μg of Spike RBD protein (Sino Biological, Cat: 40592-V08H or GenScript, Cat: Z03483). “Mock” groups received PBS alone ...
-
bioRxiv - Biochemistry 2023Quote: MCM genes were synthesised and cloned into the ampicillin resistant pONT vector by GenScript (Supplementary Table 1). Genes were positioned downstream of a T7 promoter and N-terminally His-10 tagged ...
-
bioRxiv - Immunology 2023Quote: ... Plates were coated with 500 ng/mL RBD or 1 μg/mL NP (GenScript, Piscataway, New Jersey), and heat-inactivated plasma (1:50 in blocking buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... The cDNA of human STK25 isoform 1 (RefSeq accession no. NM_001271977.2) was cloned into the pcDNA3.1+ vector (GenScript). The Q5 Site-Directed Mutagenesis Kit (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... The EspE antibody (1:5,000 dilution) was a custom rabbit polyclonal antibody against the CGQQATLVSDKKEDD peptide (Genscript).
-
bioRxiv - Bioengineering 2019Quote: ... The membrane was hybridized with a custom antibody at a 1 µg/mL dilution (GenScript, Item number: U3233DA170_2) to directly recognize the 1c19 scFv peptide (26.3KDa ...
-
bioRxiv - Biochemistry 2020Quote: ... Recombinant protein was eluted using 20 column columns purification buffer supplemented with 1 μM DYKDDDDK FLAG peptide (Genscript). Affinity purification of the TSEN-STREP construct was carried out using the STREP tag carried by the TSEN2 subunit ...
-
bioRxiv - Bioengineering 2021Quote: ... Cell adhesion was enabled in all hydrogel groups through incorporation of either 1 mM RGD peptide (GCGYGRGDSPG, Genscript) or 2 μM thiolated Fn fragments (Fn9*10 or Fn4G) ...
-
bioRxiv - Developmental Biology 2022Quote: ... the samples were incubated for 1 hr at RT with horseradish peroxidase-conjugated anti-rabbit IgG (GenScript, A00098) or anti-mouse IgG (Pronteintech ...
-
bioRxiv - Biophysics 2019Quote: ... The protein was eluted with lysis buffer added 0.05% GDN and 300 μg ml-1 Flag peptide (Genscript). The protein solution was concentrated with a 100-kDa cut-off centricon (Milipore ...
-
bioRxiv - Biochemistry 2019Quote: The cDNA for Rab8a (residues 1-181, Q67L) lacking the flexible C-terminal tail was ordered from Genscript in a codon-optimized form to enable E.coli expression ...
-
bioRxiv - Microbiology 2021Quote: ... The left and right homology donor templates and the P4::gRNA constructs (Table 1) were synthesized by GenScript and inserted into the NheI and PvuII sites of pTMS001 generating pTMS007 and pTMS008 ...
-
bioRxiv - Immunology 2020Quote: Renilla luciferease fusion protein constructs were synthesized for the Fel d 1 component of cat allergen by GenScript Biotech (Piscataway ...
-
bioRxiv - Biochemistry 2021Quote: ... and the DABCYLGlu-EDANS labelled peptides encompassing the different cleavage sites (SI Table 1) were purchased from Genscript. Reactions were performed at room temperature in black 384-well polystyrene low volume plates (CELLSTAR-Greiner Bio-One # 784476 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The loaf sgRNA sequences GCTGGTGATTACGTCGGTGA (loaf gRNA 1) and TGCGGGACCATCCGGGTACC (loaf gRNA 2) identified on www.flyrnai.org/crispr2 were made with gene synthesis in pUC57 (GenScript) and cloned into pCFD4 (Port et al ...
-
bioRxiv - Genomics 2022Quote: ... The cDNA encoding TeNT-LC-HN (residues 1-870) and TeNT-HC were synthesized by GenScript (Piscataway, NJ). A thrombin protease cleavage site was inserted between I448 and A457 in both TeNT-LC-HN and chTeNT-LC-HN ...
-
bioRxiv - Cell Biology 2023Quote: ... The pGEX-6P-1-GST-OSBP(377-807) and pET28(+)-ORP2(49-480) plasmids were purchased from Genscript. The pET22b_His6_STARD1(66-284 ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were subsequently washed with PBS and stained with α-camelid VHH antibodies (1:100, clone 96A3F5, Genscript) in 200 µl Cell Staining buffer for 30 min at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... coli were generated through custom synthesis and subcloned into an expression backbone (pETDuet-1) by Genscript (Piscataway, USA), as has been previously reported110.
-
bioRxiv - Cancer Biology 2023Quote: ... The cells were then pulsed with 20μg/ml OVA323–339 peptide (GenScript, Piscataway, NJ, Cat. No. RP10610-1) for 2 hours at 37℃ and 5% CO2 ...