Labshake search
Citations for GenScript :
751 - 800 of 1246 citations for 6 Methyl 5 4 phenyl 1 3 thiazol 2 yl 2 trifluoromethyl nicotinic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: The genes encoding full-length TcdB toxin variants (TcdB1,3 and 4) were synthesized with a C-terminal His-tag and cloned into pC-His 1622 by Genscript. The pC-His1622 vector was purchased from MoBiTec ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was separated from the insoluble material by ultracentrifugation at 180,000g for 30 min and incubated with 4 mL of Anti-DYKDDDDK G1 resin (Genscript) for 1 hour at 4℃ ...
-
bioRxiv - Biochemistry 2024Quote: Codon-optimized RdRp and VPg genes of HuNoV GII.4 Sydney strain (GenBank: AFV08794.1) were synthesized and cloned in the pET28a vector for bacterial expression by Genscript U.S.A ...
-
bioRxiv - Molecular Biology 2024Quote: ... The supernatant obtained after centrifugation of lysate for 20 min at 10,000 rpm at 4°C was loaded onto anti-DYKDDDDK G1 affinity resin (GenScript) equilibrated with buffer A ...
-
bioRxiv - Microbiology 2024Quote: Supernatants and eluted samples were run on 4-12% SurePAGE™ Bis-Tris Gels (M00652, M00653, or M00654, GenScript), followed by wet transfer to Immobilon-P polyvinylidene difluoride (PVDF ...
-
bioRxiv - Neuroscience 2024Quote: ... Then the slices were incubated overnight at 4°C with rabbit polyclonal anti-AQP4 (GenScript Biotech, Piscataway, NJ, USA) diluted 1:2000 in the blocking buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... (NM_005855.4, H-pSL056), RAMP2 (NM_005854.3, H-pSL042) and RAMP3 (NM_005856.3, H-pSL043) were purchased from Genscript (Piscataway, NJ, USA). The DNA construct of the calcitonin receptor C-terminally fused with NanoLuc luciferase [22] (Nluc_FL_CTR (H-pSL054) ...
-
bioRxiv - Cell Biology 2024Quote: ... UK). AFF3ir-ORF2 (Cat. No. C0302HL300-4) and AFF3ir-ORF1 (Cat. No. C0302HL300) antibodies were from GenScript (NJ, USA). GAPDH (Cat ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... with a unique 5′fluorescent reporter dye (FAM) and 3 fluorescent quencher dye (TAMRA) were designed using mouse mitochondrial genome sequences and synthesized by Genscript (Piscataway, NJ). For absolute quantification using qPCR ...
-
bioRxiv - Bioengineering 2020Quote: ... melanogaster U6:3 UTR that was amplified with primers 1045.C13 and 1045.C14 from a gene synthesized vector (GenScript, Piscataway, NJ) was cloned using EA cloning ...
-
bioRxiv - Immunology 2024Quote: ... M2 ORF of Ca/04 and 83 nucleotides of the 3’ end of the PB1 gene (40 nucleotides encoding the C-terminus of PB1 ORF and 43 from the 3’UTR region) was synthesized by Genscript (Piscataway, NJ). The fragments were digested with BsmBI ...
-
bioRxiv - Bioengineering 2023Quote: ... A DNA fragment for a floxed transcription stop transcription site (3 copies of SV40 late poly A sequence) followed by a H2B protein fused to mPlum was synthesized by Genscript (Piscataway, NJ) and inserted into pUC57-Kanamycin plasmid ...
-
bioRxiv - Microbiology 2024Quote: ... binding sites of bta-miRNA-16a within the 3’UTR of the bovine Furin were synthesized by a commercial provider (GenScript USA Inc). Briefly ...
-
bioRxiv - Biophysics 2020Quote: ... Inhibitors included cyclosporin A (CsA, 5 μM), hexacarboxybenzene (HCB, 10 μM) and CPSF6 peptide (100 μM, PVLFPGQPFGQPPLG, Genscript).
-
bioRxiv - Molecular Biology 2024Quote: ... The membrane was blocked (PBS, 5% non-fat milk) and probed with rabbit anti-DYDDDDK primary antibody (GenScript, 1:2,500 ...
-
bioRxiv - Microbiology 2021Quote: ... anti-SpoVAD64 (1:10,000) and anti-His (1:4,000) (GenScript) antibodies ...
-
bioRxiv - Cancer Biology 2022Quote: ... Equal amounts of protein (nominally 50 μg) from each sample were separated on 4-20% gradient Bis-Tris SDS-PAGE gels (GenScript), and protein was then electroblotted onto low autofluorescence PVDF membrane (Bio-Rad) ...
-
bioRxiv - Immunology 2021Quote: Membrane proteins from OP-treated or untreated JEG-3 or purified FC-tagged full length or truncated domains of CRT were incubated with 20 μg of NCR-Myc fusion proteins at 4° C with rotary agitation for 16 h and then with 100 μl anti-Myc coupled magnetic beads (Genscript) at 4° C with rotary agitation for 4 h ...
-
bioRxiv - Biophysics 2020Quote: ... 10 nM NS2B-NS3pro was incubated with the substrate benzoyl-Nle-Lys-Arg-Arg-7-amino-4-methylcoumarin (Bz-nKRR-AMC) (Genscript) at concentrations varying from 2 to 200 µM ...
-
bioRxiv - Neuroscience 2021Quote: ... Monomeric αSyn and αSyn oligomers were then resolved by SDS-Page into a gradient 4-20% SDS-Page gel (GenScript) and transferred to polyvinylidenedifluoride (PVDF ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: Michaelis-Menten kinetics of pre-SplB mutants were measured with the peptide substrate Ac-WELQ-AMC (Ac: acetyl-; AMC: 7-Amino-4-methylcoumarin, stock concentration: 26 mM in DMSO, concentration range: 13-1161 μM, Genscript) at an enzyme concentration of 125 nM to 2.5 μM using a Tecan infinite 200Pro (excitation wavelength 339 nm ...
-
bioRxiv - Immunology 2022Quote: ... RNA-sequencing was applied to confirm the full-length JURV genome (10,993 bp) as previously described.4 Infectious JURV was recovered from a full-length cDNA clone (Genscript, USA) comprising genes encoding for the nucleoprotein (JURV-N) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The supernatant was collected by centrifugation at 120,000g for 60 min at 4°C and then incubated with anti-DYKDDDDK Magnetic Beads (Genscript, L00835) for 1 h at 4°C ...
-
The activator domain of bacterial collagenases drives collagen recognition, unwinding and processingbioRxiv - Biochemistry 2023Quote: The coding sequences of V-B from Scl2.28 incorporating the 4 mutated tripeptides and the coding sequence of the V domain from Scl2.3 were purchased from Genscript (Germany). The modified coding sequence of V-B was cloned into a modified pET15b vector ...
-
bioRxiv - Cell Biology 2023Quote: ... 15-30 μg protein were loaded and separated by SDS-PAGE in 4–12% SurePAGE 12-well pre-cast gels (Genscript). Proteins were transferred onto PVDF membranes using iBlot or iBlot2 system (Thermo) ...
-
bioRxiv - Immunology 2024Quote: ... T2A sequence and an anti-CD19 single-chain variable fragment (scFv) fused to 4-1BB and CD3ζ stimulatory endodomains (for TRAC-CAR19-KI) were subcloned into recombinant AAV6 plasmids (GenScript). DNA sequences were flanked with 400 base-pair homology arms immediately upstream and downstream of the TET2 gRNA or TRAC gRNA cut sites ...
-
bioRxiv - Microbiology 2023Quote: Pelleted virions were dissolved in SDS-PAGE sample buffer and subjected to electrophoresis on precast 4-20% gradient gels using Tris-MOPS running buffer (Genscript). Proteins were transferred to Protran nitrocellulose membranes (Perkin-Elmer ...
-
bioRxiv - Immunology 2024Quote: ... with pGS-CMAS-Neo plasmid with sgRNA targeting exon 4 of CMAS with CCATCCCAGTCTTGTCGACG gRNA from a U6 promoter and a neomycin-resistance marker (GenScript). Clonal A549 CMAS-deficient cell lines were established by limiting dilution after selection with 800 μg/mL G418 (GeneticinTM ...
-
bioRxiv - Immunology 2024Quote: ... Gametocyte extract and 230CMB 21 samples were mixed with 4× NuPAGE™ LDS sample buffer and heated for 10 minutes at 70°C before loading on a 4–20% Bis-Tris gel (GenScript). 20 ng 230CMB was loaded per well and the Precision Plus Dual Color protein marker (Bio-Rad ...
-
bioRxiv - Molecular Biology 2024Quote: ... [32] Protein purity was confirmed by sodium-dodecyl-sulfate polyacrylamide electrophoresis (SDS-PAGE) on 4-15% gradient gels (Genscript, USA) stained with 0.0025% w/v each of Coomassie® Brilliant Blue G-250 and R-250 in 10% v/v ethanol ...
-
bioRxiv - Biochemistry 2024Quote: The peptidase activity of the 20S CP was measured using a pair of substrates: the tripeptide benzyloxycarbonyl-Val-Leu-Arg-7-amino-4-methylcoumarin (Z-VLR-AMC, Genscript) and a 11-residue oligopeptide conjugated to 7-methoxycoumarin-4-acetic acid referred to as LF211 (7-methoxycoumarin4-acetic acid (MCA)-Lys-Lys-Val-Ala-Pro-Tyr-Pro-Met-Glu-(dinitrophenyl)diaminopropionyl-NH2 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Dkk-1 (GenScript) was added to BM at final concentration of 100 ng/ml ...
-
bioRxiv - Neuroscience 2024Quote: ... FAT-1 (Genscript), and FAT-2 (Genscript ...
-
bioRxiv - Microbiology 2024Quote: ... 1 (Genscript Biotech). Additionally ...
-
bioRxiv - Immunology 2024Quote: ... – BMDC of Pink1−/− mice were stained with Tag-it Violet as described previously and then coated on ice for 3 hours with the mitochondrial peptide pool (custom synthesis by Genscript or Canada Peptide) or mock pool (OVA 257-264 ...
-
bioRxiv - Microbiology 2021Quote: ... heated for 8 minutes at 95°C and run on a precast 4-12% Bis-Tris PAGE gel (Genscript, Cat# M00654). Protein was transferred to a nitrocellulose (NC ...
-
bioRxiv - Cell Biology 2022Quote: ... 20-50 μg of protein lysate of each sample was loaded and separated on 4-12% Bis-Tris gels (Thermo Fisher or GenScript) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... Blocking buffer was removed and replaced with 20 mL blocking buffer supplemented with 4 μL anti-HIS primary antibody (mAb, mouse, GenScript®) and the blot was incubated overnight at 4°C with agitation ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Lysates were mixed with Native-PAGE sample buffer 5X (Beyotime) and subjected to Native-PAGE using ExpressPlus™ 4-12% PAGE Gel (GenScript) and Tris-MOPS-SDS Running Buffer (GenScript) ...
-
bioRxiv - Microbiology 2021Quote: ... active protein fractions were further separated through sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE; 4%–20% Bis-Tris Gel; GenScript, USA). Proteins in the gel slices were eluted in HEPES-K+ buffer (50 mM ...
-
bioRxiv - Microbiology 2021Quote: ... and 20 μg of protein lysates from each sample were denatured in 4X LDS sample buffer followed by separation on 4–12% gradient SDS PAGE polyacrylamide gel (Genscript, #M00653). Separated proteins on the polyacrylamide gel were transferred to a 0.2 μm PVDF membrane (Thermo Scientific ...
-
bioRxiv - Biochemistry 2023Quote: ... was used to measure total protein content to enable equal loading of protein onto 4-12% precast mini polyacrylamide gels (SurePAGE™, GenScript). Proteins were transferred onto polyvinyl difluoride (PVDF ...
-
bioRxiv - Biochemistry 2024Quote: ... Cell debris were removed by centrifugation (10,000 x g for 10 min at 4°C) and the supernatant was incubated with 30 μL of protein A/G-coated magnetic beads (Genscript L00277) for 1 hour at 4 °C to remove nonspecifically bound proteins ...
-
bioRxiv - Molecular Biology 2022Quote: Equal sample concentrations (100 μg of total protein per well) were resolved in 4%–20% electrophoresis gradient gels (Genscript, Cat. M00656) and transferred onto polyvinylidene difluoride (PVDF ...
-
bioRxiv - Microbiology 2024Quote: ... An equivalent amount of total proteins was loaded in each lane and resolved on a 15% SDS-PAGE gel or 4-12% SurePAGE™ Bis-Tris gel (Genscript), transferred to nitrocellulose by electroblotting ...
-
bioRxiv - Biophysics 2024Quote: Samples were quenched using 4X non-reducing Laemmli SDS sample buffer (TPpro, Taiwan) and then separated on 4-20% gradient SDS gels (GenScript, USA). Visualization of protein bands was carried out using an iBright FL1000 system (ThermoFisher ...
-
bioRxiv - Microbiology 2020Quote: ... Membranes were blocked with 5% milk in PBS+0.1%Tween-20 and probed with anti-EnvP sera or mouse anti-GAPDH antibody (Genscript), followed by goat anti-mouse HRP (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... the PVDF membrane was blocked by 5% skim milk in TBST and incubated with HRP-conjugated streptavidin (GenScript, M00091) for the enhanced chemiluminescence detection ...
-
bioRxiv - Microbiology 2021Quote: ... The resin was washed with 60 mL of buffer A supplemented with 2 mM CaCl2 and the bound protein was eluted from the column with 10 mL of buffer A supplemented with 5 mM EDTA and 0.2 mg/mL FLAG peptide (Genscript).
-
bioRxiv - Molecular Biology 2023Quote: ... cells were treated with 5 μM of recombinant (PR)20 peptides (with a C-terminal HA epitope tag, Genscript) for 10 days ...