Labshake search
Citations for GenScript :
701 - 750 of 930 citations for Son of sevenless homolog 1 SOS1 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
CRISPR-based environmental biosurveillance assisted via artificial intelligence design of guide-RNAsbioRxiv - Molecular Biology 2024Quote: ... 1 µL of 10 µM reporter (poly-U5 or poly-U15, GenScript, custom), 0.96 µL of 10 µM forward primer (GenScript ...
-
bioRxiv - Microbiology 2024Quote: ... (30) using anti-OROV nucleoprotein IgG (1:100 dilution; custom made by Genscript). Primary delete and no infection controls were performed to identify non-specific binding of the secondary detection antibody or all reagents ...
-
bioRxiv - Bioengineering 2021Quote: ... Hydrogel precursor solution was prepared by incorporating thiolated RGD peptide (GCGYGRGDSPG, 1 mM, Genscript) to promote integrin-mediated cell adhesion and lithium acylphosphinate (LAP ...
-
O-GlcNAcylation reduces phase separation and aggregation of the EWS N-terminal low complexity regionbioRxiv - Biochemistry 2021Quote: ... residues 1-264 (N-terminal LCR; LCRN) was synthesized by GenScript (Piscataway, NJ, USA) with codon optimization for expression in Escherichia coli ...
-
bioRxiv - Neuroscience 2022Quote: ... we inserted the designed sgRNA to target exon-1 of Ezrin (TGGCTGGTTGGTGGCTCTGCGTGGGT) (Genscript: NM_001271663.1_T3). Finally ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Bipartite proteins were detected using the rabbit anti-mCherry (A00682, GenScript, 1:3000 diluted), the mouse anti-His (A00186 ...
-
bioRxiv - Immunology 2020Quote: HLA-A*0201-restricted MART-1 peptide ELAGIGILTV) was synthesized by GenScript (Nanjing, China). Peptide was stored at 10 mg/ml in 100% dimethyl sulfoxide (DMSO ...
-
bioRxiv - Immunology 2020Quote: MART-1 originated peptide ELAGIGILTV (HLA-A*0201) was synthesized by GenScript (Nanjing, China) with a purity of ≥ 99.0% ...
-
bioRxiv - Biophysics 2022Quote: Full-length human 2’-5’-oligoadenylate synthase 1 (OAS1) has been purchased from Genscript and cloned in the pRSF-Duet1 vector ...
-
bioRxiv - Cancer Biology 2022Quote: FITC-CCNL1321-332 peptides (numbering according to Uniprot Q9UK58-1) were purchased from GenScript and FITC-cyclin E377-384 peptides (numbering according to Uniprot P24864-3 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Sequences were split into 1–1.5 kilobase fragments and ordered as GenParts from GenScript. Primers were ordered from QuintaraBio to amplify from the ends of each GenPart ...
-
bioRxiv - Cancer Biology 2024Quote: ... and diluted 1:5000 HRP-conjugated goat anti-rabbit IgG (cat no. A00098, GenScript) were used as secondary antibodies ...
-
bioRxiv - Molecular Biology 2022Quote: ... VHL 3KR-14-3-3ζ (1-230) 19KR K49E mutation were synthesized by GenScript Biotech ...
-
bioRxiv - Molecular Biology 2023Quote: ... pcDNA3.1-C-FLAG containing human ATP6V1H transcript variant 1 (NM_015941.4) was purchased commercially (GenScript). pcDNA3.1-ATP6V1H(1-351)-FLAG ...
-
bioRxiv - Bioengineering 2023Quote: ... Cell adhesion was enabled through the incorporation of 1 mM RGD peptide (GCGTGRGDSPG, Genscript) in all hydrogel groups.
-
bioRxiv - Immunology 2024Quote: ... Cells were then stimulated with 1 μM of test peptides (custom peptide synthesis, GenScript) or control reagents as indicated in each relevant figure legend and costimulatory antibodies anti-CD28 (BD Biosciences ...
-
bioRxiv - Plant Biology 2024Quote: WT or mutated lysine 4 trimethylated H3 (1-20aa) peptides were synthesized by GenScript Biotech Corporation ...
-
bioRxiv - Immunology 2024Quote: ... Serum samples were diluted (1:10) and preincubated with 100 ng/ml RBDmFc (Genscript) in blocking buffer for 1 hour at room temperature ...
-
bioRxiv - Biochemistry 2024Quote: ... and eluted by W1 buffer supplemented with 250 μg ml-1 Flag peptide (Genscript). The eluent was concentrated and further purified by size-exclusion chromatography (Superose-6 Increase 10/300 column ...
-
bioRxiv - Molecular Biology 2020Quote: HCoV-19 S gene (virus isolate: Wuhan Hu-1; GenBank number QHD43416.1) was synthesized (Genscript) with codons optimized for insect cell expression ...
-
bioRxiv - Bioengineering 2021Quote: The 14 designs chosen for experimental tests from PIP version 1 were ordered from GenScript pre-cloned into the pET-21a expression vector ...
-
bioRxiv - Microbiology 2020Quote: ... The expression of each anti-HIV-1 CAR was detected by protein L-biotin (GenScript) and Alexa488-conjugated anti-human Fc antibody or APC-conjugated anti-human Fc antibody as described elsewhere [78] ...
-
bioRxiv - Biochemistry 2022Quote: cDNA constructs for expression of recombinant Mac-1 in mammalian cells were generated by GenScript. ITGAM cDNA was cloned into the vector pcDNA3.1/HygroB(+) ...
-
bioRxiv - Immunology 2021Quote: ... were coated with 100 µL of SARS-CoV-2 RBD (1 µg/mL) (GenScript, USA) in carbonate bicarbonate buffer (pH 9.6 ...
-
bioRxiv - Microbiology 2021Quote: Microtiter plates (96-well; Thermo) were coated with 1 μg/mL S-2P protein (Genscript) corresponding to the S protein of the Wuhan-Hu-1 virus ...
-
bioRxiv - Biochemistry 2021Quote: ... the codon-optimized WP_011499504.1 ORF was subcloned into pGEX-4T-1-H expression vector (Genscript) to create pGEX4T1_ WP011499504 ...
-
bioRxiv - Biophysics 2020Quote: The gene corresponding to residues 1-201 of colicin 5 (colE5-T) was synthesized (GenScript) and cloned into pET21(+ ...
-
bioRxiv - Immunology 2020Quote: ... N-terminal biotinylated peptides of PyCSP[NXA] listed in Table 1 were obtained from GenScript and used in epitope mapping ELISAs.
-
bioRxiv - Molecular Biology 2022Quote: ... coli optimized coding sequence for human FMRP (isoform 1) was designed and synthesized by Genscript, and then subcloned into pET His6 MBP TEV LIC cloning vector (1M) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Diluted 1:5000 horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG (cat no. A00160; GenScript) and diluted 1:5000 HRP-conjugated goat anti-rabbit IgG (cat no ...
-
bioRxiv - Cell Biology 2024Quote: ... Clarified lysates were incubated with 1 mL Anti-DYKDDDDK (FLAG) Affinity Resin (Genscript; Piscataway, NJ) for 2 h at 4 °C and then washed with 10 column volumes (CVs ...
-
bioRxiv - Cancer Biology 2024Quote: ... and TTK genes were introduced in PANC-1 using pcDNA3.1+/C-(K)-DYK (GenEZ; GenScript) vectors (10 µg/ml) ...
-
bioRxiv - Molecular Biology 2022Quote: We purchased the full-length human LRRK1 gene from Genscript (residues 1-2015, uniprot Q38SD2), codon optimized for Homo sapiens ...
-
bioRxiv - Physiology 2023Quote: ... Tyrosine-substituted (Y134A) and N-terminal (1-96 aa) truncated mutants were purchased from GenScript Biotech (Piscataway ...
-
bioRxiv - Biochemistry 2024Quote: ... and competence was induced by adding 500 ng/mL competence-stimulating peptide (CSP-1; GenScript). After 15 min incubation ...
-
bioRxiv - Biophysics 2024Quote: ... coli and cloned into the 5’BamHI and 3’XhoI sites of pGEX6P-1 (GenScript).
-
bioRxiv - Biochemistry 2021Quote: ... and 1 mM DTT and incubated with magnetic glutathione beads (L00327; GenScript Biotech, Piscataway, NJ, USA) loaded with recombinant GST-tagged AF1521 for 2 to 4 hours at 4°C with rotation ...
-
bioRxiv - Immunology 2021Quote: ... chimeric group 1 or group 2 stalk proteins expressed in Sf9 cells were column purified (GenScript). For functional assays and luminex Fc receptor binding and titer ...
-
bioRxiv - Biophysics 2022Quote: ... and pBAD33mut-LTR-III WT and pBAD33mut-PARP-1 WT vectors were synthesized and cloned (Genscript) into pBAD33mut vector using the SacI and SpeI restriction enzyme sites ...
-
bioRxiv - Plant Biology 2022Quote: ... whereas the autoubiquitination was detected by IB analysis with anti-GST (A00865-200, 1:5,000, Genscript) as primary antibody ...
-
bioRxiv - Cell Biology 2024Quote: Wild-type and analog-sensitive Chk2 ORF sequences were cloned in the pGex6p-1 plasmid (Genscript, see plasmid construction section for details ...
-
bioRxiv - Cell Biology 2023Quote: ... accession number XM_006514830.3) and type 3 (transcript variant 1, accession number NM_001363282.1) was purchased from GenScript (Clone IDs OMu45282 and OMu45285 ...
-
bioRxiv - Cell Biology 2023Quote: ... rabbit anti-Akr1B-2 at 1:100,000 (produced to full-length Drosophila p23 (Q9VH95) by GenScript) and mouse anti-α-Tubulin at 1:5000 (AB_477593 ...
-
bioRxiv - Immunology 2024Quote: ... P30 (CP204L) genes from Georgia 2007/1 strain (NCBI Reference Sequence: NC_044959.2) were synthesized by GenScript and inserted into the phCMV mammalian cell expression vector (MoBiTec) ...
-
bioRxiv - Genetics 2024Quote: lon-1 ORF with codons optimized for expression in Escherichia coli was synthesized by GenScript (Rijswijk). Its coding sequence devoid of the signal sequence (starting at Glycine 24 ...
-
bioRxiv - Biochemistry 2021Quote: All peptides (see all sequences in Supplementary Tables 1) were purchased at 95% purity (Genscript, Leiden, Netherlands). NAD was purchased from Roche (Basel ...
-
bioRxiv - Cell Biology 2021Quote: ... Three human codon-optimized As-NF-κB (named 1, 2, and 3) cDNAs were synthesized by GenScript based on sequences from the transcriptome of A ...
-
bioRxiv - Cancer Biology 2020Quote: ... the PD-L1-lnc shRNA vectors were synthesized and then cloned into pLKO.1 vector (GenScript, China). The siRNA target sequences were listed in table S3 ...
-
bioRxiv - Biophysics 2022Quote: The C terminal domain of Influenza A Matrix protein 1 (M1C) was subcloned into pET15b vector (GenScript). In addition to the M1C sequence ...
-
bioRxiv - Biophysics 2020Quote: ... After the dialysis step we applied 1:100 stoichiometric molar ratio 3C protease (PreScission protease, GenScript, USA) to cleave the C-terminal hexa-histidine tag of construct-1 with native N- & C-terminals ...