Labshake search
Citations for GenScript :
701 - 750 of 1281 citations for Recombinant Human Catenin cadherin associated protein Beta 1 88kDa His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: All constructs for human expression were generated through custom synthesis and subcloned into a pcDNA3.1 backbone by Genscript (Piscataway, USA). All constructs for GFP expression in E ...
-
bioRxiv - Immunology 2023Quote: ... and were codon-optimized for human cell expression and made in the CMV/R vector (Barouch et al. 2005) by Genscript with a C-terminal hexahistidine affinity tag ...
-
bioRxiv - Biochemistry 2023Quote: The DBC1-NHD fragment (residues 354-396) derived from the human DBC1 (Uniprot code: Q8N163) was synthesized and subsequently cloned into the pETM41 vector by GenScript Biotechnology Co. ...
-
bioRxiv - Biochemistry 2023Quote: The full-length cDNAs for human SIDT1 and SIDT2 (Uniport: Q9NXL6 and Q8NBJ9, respectively) were codon-optimized and synthesized by GenScript Co. ...
-
bioRxiv - Immunology 2023Quote: DNA fragments that encode SARS-CoV-2 variant RBD (Spike 319-541) were codon-optimized for human cell expression and synthesized by Genscript. His-AVI tags were added at the end of the fragments ...
-
bioRxiv - Biochemistry 2023Quote: Human Mint1 sequences for bacterial expression were codon optimised and sub-cloned into the pGEX4T-2 plasmid by Genscript (USA). The constructs generated were GST-tagged Mint1(226- 314)(MID) ...
-
bioRxiv - Cell Biology 2024Quote: ... (Biotin-GRMTNGAMNVEIGNPTYKMYEGGEPDDG) and LRP1 (NPXA) (Biotin-GRMTNGAMNVEIGNPTAKMYEGGEPDDG) peptides corresponding to human LRP1 amino acid residues 4458-4483 were purchased from GenScript and ...
-
bioRxiv - Biophysics 2024Quote: ... A pET28a(+) plasmid containing an open reading frame for human hnRNPA1 with an N-terminal 6xHis tag was synthesized by GenScript. The 6xHis-hnRNPA1 was expressed in E ...
-
bioRxiv - Cell Biology 2019Quote: The proteins were codon optimized for eukaryotic expression and de novo synthesized by GenScript.
-
bioRxiv - Biochemistry 2020Quote: ... 293T cells were transiently transfected with plasmids expressing SARS-CoV-2 spike protein (GenScript MC_0101081 ...
-
bioRxiv - Neuroscience 2020Quote: ... SARS-CoV-2 Spike protein (S1 domain aa16-685, Cat# Z03485, Genscript, Piscataway, NJ) was added at concentrations ranging from 0.07 to 500 to nM ...
-
bioRxiv - Immunology 2020Quote: Plasmids encoding cDNAs for hMPV F proteins listed in Table S1 were synthesized (GenScript) and cloned into the pcDNA3.1+ vector ...
-
bioRxiv - Cell Biology 2021Quote: ... 25 μg protein from each sample was mixed with LDS Sample Buffer (M00676, GenScript) and loaded in each well of a 4-20% SurePAGE™ Bis-Tris gel (M00656 ...
-
bioRxiv - Bioengineering 2022Quote: We obtained the genes encoding the designed proteins in pET28a vectors from GenScript (Genscript.com). We confirmed the sequences of all the constructs by DNA sequencing (Eton bioscience ...
-
bioRxiv - Plant Biology 2019Quote: ... SlMai1-myc or synSlMai1-myc proteins were detected using anti-Myc antibodies (GenScript; A00704) and chemilumiscent ECL Plus substrate (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... All the proteins were endotoxin free (ToxinEraserTM Endotoxin Removal Kit, GenScript Biotechnology, Nanjing, China).
-
bioRxiv - Microbiology 2022Quote: ... 10^5 splenocytes were seeded and stimulated with peptides against S protein (From GenScript) (2μg/ml ...
-
bioRxiv - Microbiology 2021Quote: ... gene segment containing spike protein of SARS-CoV-2 wa s synthesized by GenScript Inc ...
-
bioRxiv - Microbiology 2020Quote: Mouse mAb 10G6H5 against SARS-COV2 S protein was purchased from GenScript (Piscataway, NJ). Rabbit antisera against the S1 subunit ...
-
bioRxiv - Immunology 2020Quote: ... ELISA plates were coated with 200 ng/well CoV2 RBD protein (GenScript; Cat: Z03483) overnight at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... GiGrx5 and GiBolA proteins were detected by a rabbit anti-BAP polyclonal antibody (GenScript). Mitosomal GiTom40 and GiIscU were detected with a specific polyclonal antibody raised in rabbits (84) ...
-
bioRxiv - Microbiology 2022Quote: ... fumigatus-optimized fluorescent protein mNeonGreen by using vector pSR25 (synthesized by GenScript, Piscataway, NJ). Primer pairs AtrR-CoNG MH F (CCCGGTCTTCGACACCA ATGGTCCACCCCACGGTGGATTGGCTGGTGCCGGTGCTGGT ...
-
bioRxiv - Biophysics 2022Quote: ... The fusion protein MBP-Q44-HttEx1 was subcloned into a pMalc2x plasmid by Genscript. The protein expression was done in Escherichia coli BL21(DE3 ...
-
bioRxiv - Microbiology 2023Quote: Full-length wMel WalE1 and wAna FtsZ protein-encoding constructs were synthesized by GenScript using codons optimized for E ...
-
bioRxiv - Cell Biology 2023Quote: ... DCP-Bio1-bound proteins were pulled down with Streptavidin-coated magnetic beads (Genscript #L00936) overnight at 4 °C following manufacturer’s protocol ...
-
bioRxiv - Genetics 2023Quote: ... MgR protein was purified by passing through a column Nickle resin (GenScript Biotech Co.) and washed by using 3 column volumes of wash buffer (50 mM Tris-HCl at pH 8.0 ...
-
bioRxiv - Biochemistry 2024Quote: ... Digested product was bound to 500 µL of protein A resin beads (GenScript #L00210) overnight at 4℃ on a rotating shaker ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein samples were electroporated on 4-20% gradient SurePAGE™ Bis-Tris gel (Genscript) or 4-20% Tris-glycine gel (BioRad ...
-
bioRxiv - Immunology 2023Quote: ... supernatants containing the monoclonal antibodies were purified using protein A magnetic beads (Genscript, L00695). The purified samples were determined by SDS-PAGE.
-
bioRxiv - Microbiology 2024Quote: ... and synthetic fragments and genes encoding the fluorescent proteins from Genscript (Supplementary Table 2).
-
bioRxiv - Microbiology 2020Quote: ... samples were added in duplicate (100μl/well) followed by the addition of the anti-human IgG-Fc-HRP (GenScript No. A01854) conjugate (diluted 1:10,000 ...
-
bioRxiv - Cell Biology 2020Quote: FLOE1 and derived mutant constructs for expression in human cells were optimized for human expression (Table S3) and generated through custom synthesis and subcloning into the pcDNA3.1+N-eGFP backbone by Genscript (Piscataway, USA).
-
bioRxiv - Cell Biology 2021Quote: PopZ and derived mutant constructs for expression in human cells were generated through custom synthesis and subcloning into the pcDNA3.1+N-eGFP backbone by Genscript (Piscataway, USA). The mCherry-G3BP1 plasmid was a kind gift of Dr ...
-
bioRxiv - Immunology 2021Quote: Antibodies inhibiting virus binding to host cell was measured using a commercial RBD-human angiotensin-converting enzyme 2 (hACE2) binding inhibition assay called cPASS™ (GenScript). As per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... The human LEP mRNA sequence was sourced from the cDNA construct hLEP-pcDNA3.1(+)-C-(K)DYK (GenScript, clone ID OHu27387; NM_000230.3). Leptin-SBP-HaloTag plasmid was generated by inserting the WT LEP gene into the backbone derived from pMPx92 using restriction digest and Gibson assembly ...
-
bioRxiv - Genetics 2020Quote: ... Notch 2 (1:100; LSBio) and Presenillin-1 (1:100; Genscript) overnight at 4°C ...
-
bioRxiv - Pathology 2022Quote: ... Jagged-1 peptide (1 uM, Genscript), Y-27632 (10 uM ...
-
bioRxiv - Biochemistry 2020Quote: ... DNA polynucleotides encoding the transmembrane domains showing homology to previously known ACRs optimized for human codon usage were synthesized (GenScript, Piscataway, NJ) and cloned into the mammalian expression vector pcDNA3.1 (Life Technologies ...
-
bioRxiv - Immunology 2021Quote: ... Gene encoding Spike of SARS-CoV-2 (GenBank NC_0101080) codon-optimized for human codon usage (GenBank MC_0101081) was purchased from Genscript (pUC57-2019-nCoV-S). RBD was used to generate a fragment encoding RBD-SSGGASVLA linker-recombinant ferritin ...
-
bioRxiv - Synthetic Biology 2023Quote: ... with 50 nM human HER2:AF647 (Acro Biosystems) and 30 nM anti-VHH probe (MonoRab anti-Camelid VHH [iFluor 488], GenScript cat #A01862). The SARS-CoV-2 VHH strains were resuspended in saponin based stain buffer (1x PBS ...
-
bioRxiv - Immunology 2022Quote: Synthetic peptides containing the N-loop or the C-terminal sequence of human chemokines were designed and obtained (> 75% purity) from GenScript (Hong Kong). All peptides are biotinylated (biotin-Ahx ...
-
bioRxiv - Biophysics 2020Quote: The cDNA sequences for the protein variants used in the study were purchased from GenScript and the proteins were N-terminally tagged with a 6xHis-Lipo domain ...
-
bioRxiv - Cancer Biology 2019Quote: ... The sonicated DNA-Protein complexes were immunoprecipitated with the following antibodies: control IgG (A01008, GenScript), anti-TFAP2C (sc-12762 ...
-
bioRxiv - Microbiology 2019Quote: ... The blot was washed and secondary antibody (for Ryp proteins: Goat α-rabbit HRP (GenScript) 1:1,000 ...
-
bioRxiv - Biochemistry 2021Quote: Codon-optimized open reading frames for EuRe and BoMoC RT proteins were ordered from GenScript. Proteins were produced in Escherichia coli by expression from MacroLab vector 2bct with a C-terminal 6xHis tag (https://qb3.berkeley.edu/facility/qb3-macrolab/#facility-about ...
-
bioRxiv - Microbiology 2021Quote: Polyclonal Rabbit antibodies against the potential S-Layer protein of A_DKE were generated by GenScript Biotech B ...
-
bioRxiv - Neuroscience 2020Quote: ... SARS-CoV2 Spike protein (100 nM, S1 domain aa16-685, Cat# Z03485, Genscript, Piscataway, NJ), EG00229 (Cat#6986 ...
-
bioRxiv - Plant Biology 2021Quote: ... Accumulation of FHT-HA protein was assayed by immunoblot with a monoclonal HA antibody (GenScript).
-
bioRxiv - Biochemistry 2021Quote: ... 15 μg total protein was loaded and resolved on Bis-Tris 4-12% gels (GenScript) and transferred to a polyvinylidene difluoride (PVDF ...
-
bioRxiv - Immunology 2022Quote: ... vaccines consisted of either SARS-CoV-2 Spike RBD WH-01 protein (GenScript; cat# Z03483) or SARS-CoV-2 WH-01 Spike protein (Acro Biosystems ...