Labshake search
Citations for GenScript :
701 - 750 of 946 citations for Dengue Virus Serotype 3 Envelope Protein Mouse Fc Tag HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: Pre-validated gRNA sequences targeting the exon 3 of BMP4 or BMP7 gene were obtained from genome-wide databases provided by GenScript (https://www.genscript.com/gRNA-database.html ...
-
bioRxiv - Molecular Biology 2023Quote: ... and either amplified from a clinical isolate (FR-3 and Muc) and cloned into a modified pUC19 backbone (fragments A-D) or de novo synthesized (GenScript) and cloned into a pUC57 backbone (fragments A-C).
-
bioRxiv - Molecular Biology 2022Quote: ... Selected mouse IgG and IgK chains were cloned into humanized IgH and IgL vectors (Genscript).
-
bioRxiv - Biochemistry 2022Quote: ... for >5 min at room temperature and incubated with mouse anti-His antibody (Genscript A00186) at 0.1 µg/ml in EveryBlot buffer for 1 hr at room temperature or overnight at 4 °C ...
-
bioRxiv - Developmental Biology 2023Quote: ... Dlx5 and Pbx1 coding sequences were amplified from mouse cDNA and cloned into pcDNA3.1 (Genscript). Meis2 vector was mutated with NEBuilder HiFi DNA Assembly kit (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: ... Diluted 1:5000 horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG (cat no. A00160; GenScript) and diluted 1:5000 HRP-conjugated goat anti-rabbit IgG (cat no ...
-
bioRxiv - Neuroscience 2020Quote: ... Purified monomer protein passed through two to three rounds of endotoxin removal (Endotoxin removal kit, GenScript) to reach a level of <0.1 EU mg-1 ...
-
bioRxiv - Biochemistry 2021Quote: ... Samples were next incubated under constant agitation with 10% (v/v) Protein-A-Sepharose beads (Genscript) for a further 2 h at 4°C before recovery by centrifugation at 13,000 g for 1 min ...
-
bioRxiv - Immunology 2021Quote: ... chimeric group 1 or group 2 stalk proteins expressed in Sf9 cells were column purified (GenScript). For functional assays and luminex Fc receptor binding and titer ...
-
bioRxiv - Microbiology 2021Quote: Plasmids encoding cDNA for hMPV 130-BV F and hMPV B2 F proteins were synthesized (GenScript) and cloned into the pcDNA3.1+ vector as previously described (29 ...
-
bioRxiv - Cell Biology 2020Quote: Proteins were separated by SDS-PAGE on 4%-20% MOPS-acrylamide gels (GenScript Express Plus, M42012) and electrophoretically transferred onto Immobilon PVDF membranes (Fisher ...
-
bioRxiv - Bioengineering 2022Quote: ... The experiments were performed by direct immobilization of the recombinant IL6 protein (Cat. No. Z03034, Genscript), on a CM5 biosensor chip surface (Cytiva ...
-
bioRxiv - Biophysics 2022Quote: Genes encoding all NS1 EDs and p85β proteins were prepared by gene-synthesis service from Genscript: 1918 NS1 (residues 80 to 205) ...
-
bioRxiv - Immunology 2020Quote: ... cell culture media were clarified by centrifugation and the IgG captured using Protein G resin (Genscript). IgG were eluted from the resin using 100 mM glycine pH 3.0 ...
-
Sterilizing immunity against SARS-CoV-2 in hamsters conferred by a novel recombinant subunit vaccinebioRxiv - Microbiology 2020Quote: ... Coomassie brilliant blue staining for SDS-PAGE were performed using eStain L1 Protein Staining machine (Genscript). Gels for western blot were transferred onto the nitrocellulose membrane and reacted with COVID-19-convalescent serum (1:500 diluted) ...
-
bioRxiv - Neuroscience 2020Quote: ... and equal amounts of protein were separated on a 4-12% SDS-gel (Genscript SurePAGE™). Proteins were transferred onto a PVDF Immobilon-P (0.45 µm Millipore) ...
-
bioRxiv - Cancer Biology 2021Quote: ... protein – NP_001058.2) cloned into pcDNA3.1+/C-(K)-DYK vector (Clone ID OHu21029D) was purchased from Genscript. The cDNAs were cloned into a bacterial expression vector ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The Hdp1opt and Hdp1opt L27Q proteins used for the in vitro experiments were synthesized by GenScript and resuspended in water for a stock concentration of 1 mg/ml.
-
bioRxiv - Immunology 2022Quote: ... vaccines consisted of 10 µg SARS-CoV-2 Spike RBD WH-01 protein (GenScript, cat# Z03483), combined with 1 nmol AMP-CpG-7909 (AMP-CpG ...
-
bioRxiv - Microbiology 2020Quote: ... 60 or 100 nM of his/FLAG-tagged SARS-CoV-2 spike protein (GenScript, Z03481-100) was added to each well ...
-
bioRxiv - Immunology 2020Quote: Templates for the expression of proteins UF1 to UF6 were prepared by gene synthesis (GenScript, USA). Before synthesis ...
-
bioRxiv - Biochemistry 2021Quote: ... Seven µg of total protein were loaded on an SDS-PAGE gel (GenScript, New Jersey, USA), and then transferred to a PVDF membrane as previously described [42] ...
-
bioRxiv - Biochemistry 2021Quote: ... The wild-type protein and the mutant K96A cloned in pET28a vector were ordered from GenScript. The N-terminally truncated constructs were cloned by amplifying the sequence from the original vector and subcloning into BsaI-cleaved plasmid pNIC28_Bsa4 by SLiCE cloning (83) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The supernatants were incubated with 30 µl of protein A/G-coated magnetic beads (Genscript L00277) to remove the nonspecifically bound proteins for 1 hour at 4 °C with agitation ...
-
bioRxiv - Immunology 2021Quote: ... The SARS-CoV-2 spike protein (ECD) and RBD were purchased from GenScript (Piscataway, NJ, USA).
-
bioRxiv - Neuroscience 2022Quote: ... The purified proteins were made endotoxin free using the Toxineraser endotoxin removal kit (Genscript, Piscataway, NJ). For fibrillation ...
-
bioRxiv - Immunology 2022Quote: ... B2 F and hMPV B2F-GCN4 recombinant proteins were synthesized from the plasmids obtained from GenScript cloned into pcDNA3.1+ vector ...
-
bioRxiv - Molecular Biology 2022Quote: The α2 portion of the human α2δ1 protein (NCBI reference sequence NP_00713.2) was produced by GenScript Protein Expression and Purification Services (GenScript Corp ...
-
bioRxiv - Microbiology 2023Quote: ... and the size of bands was indicated by broad multi-color pre-stained protein standard (GenScript). Edman sequencing was performed on a Shimadzu PPSQ-53A at the Iowa State University Protein Facility ...
-
bioRxiv - Cell Biology 2022Quote: M1 ubiquitinated proteins were enriched using GST-tagged UBAN-coupled Glutathione MagBeads (Genscript, Piscataway NJ, SA), as described previously 116 ...
-
bioRxiv - Immunology 2022Quote: ... cell culture media was clarified by centrifugation and the IgG captured using Protein G resin (Genscript). The IgG were eluted from the Protein G resin using 100 mM glycine pH 3.0 ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein concentration from supernatants was measured and ran in 7.5% polyacrylamide gels using MOPS buffer (GenScript) at 130 V ...
-
bioRxiv - Microbiology 2023Quote: ... and visualized by Coomassie blue stain using the eStain protein stain system (GenScript, Piscataway, NJ, USA). Protein identity was verified by Edman degradation by the Protein Chemistry Section of the Research Technologies Branch ...
-
bioRxiv - Microbiology 2023Quote: ... were generated via gene synthesis and cloned to produce 6xHis-tagged proteins by Genscript (Piscataway, NJ). Briefly ...
-
bioRxiv - Molecular Biology 2023Quote: ... Immunoprecipitations were performed using 0.5μg IgG or RBM10 antibody and protein A magnetic beads (GenScript #L00273) incubated with 2mg lysate overnight at 4°C ...
-
bioRxiv - Genetics 2023Quote: Proteins were separated by SDS-PAGE on 4%-20% MOPS-acrylamide gels (GenScript Express Plus, M42012) and electrophoretically transferred onto PVDF membranes ...
-
bioRxiv - Cancer Biology 2024Quote: ... Medium was collected 7 days post-transfection and mAbs were purified using protein A resin (Genscript) affinity chromatography and eluted in PBS (pH 7.4) ...
-
bioRxiv - Molecular Biology 2020Quote: ... AGO1/2 and AGO1/2/3 knockout cell lines used for RNAseq were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...
-
bioRxiv - Microbiology 2021Quote: ... a synthetic 999 bp fragment of the recodonized version of the CpMetRS (starting from amino acid number 247) along with the 3’UTR sequence of the enolase gene (cgd5_1960) was purchased (GenScript, NJ, USA). The synthetic construct was PCR amplified to introduce desired mutations and the 5’ homology region was introduced as an overhang in the forward primer ...
-
bioRxiv - Molecular Biology 2021Quote: ... and AGO1/2/3 knockout cell lines used for RNAseq were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...
-
bioRxiv - Cancer Biology 2023Quote: ... with an empty vector (PC) or a vector against Bach1 with the following gRNA 5’ GCGGTTCCGAGCCCACCGCT 3’ (GenScript Biotech Corporation, USA) (BACH1 KO ...
-
bioRxiv - Cell Biology 2019Quote: ... Anti-EphB1 mouse monoclonal against EphB1 sequence (AA 528-541, DDDYKSELREQLPL) was custom made by GenScript. N-terminal biotin labeled cell permeable antennapedia peptide (AP ...
-
bioRxiv - Immunology 2021Quote: ... A peptide representing the mouse ANGPTL4 amino acids 29-53 (29QPEPPRFASWDEMNLLAHGLLQLGH53) was also synthesized by Genscript) with the same C-terminal-GGGC modification ...
-
bioRxiv - Biochemistry 2022Quote: ... The sequence encoding mouse α-DG lacking the N-terminal domain (H30 – A316) was synthesized (Genscript) and cloned into the AAV backbone under the transcriptional control of the muscle-specific MCK promoter ...
-
bioRxiv - Cancer Biology 2023Quote: The p53-5H7B9 mouse monoclonal antibody (subclass IgG2a) was purchased from GenScript (catalog number A01767-40) as lyophilized protein in PBS ...
-
bioRxiv - Biophysics 2021Quote: pET30a vectors encoding proteins WP_032523104.1 and OAD22177.1 (referred to as Pr12 and Pr17, respectively) were prepared by Genscript. Both proteins were produced without signal peptides (residues 1-22 for Pr12 and residues 1-18 for Pr17 ...
-
bioRxiv - Molecular Biology 2021Quote: ... with 1 ug of anti-UPF1 or anti-ARS2 antibodies and protein A/G magnetic beads (Genscript). The next day ...
-
bioRxiv - Bioengineering 2021Quote: Recombinant human GILT-R37A-GAA protein was produced in HD Chinese hamster ovary cells and purified (Genscript). Cell culture supernatant was centrifuged ...
-
bioRxiv - Biophysics 2022Quote: The full-length E-protein sequence from SARS-CoV-2 (GenBank Accession: NC_045512.2) was purchased from GenScript as a synthetic gene with optimized codon use for expression in Xenopus laevis ...
-
bioRxiv - Biophysics 2022Quote: The C terminal domain of Influenza A Matrix protein 1 (M1C) was subcloned into pET15b vector (GenScript). In addition to the M1C sequence ...