Labshake search
Citations for GenScript :
701 - 750 of 967 citations for Alpha 1 6 Fucosyltransferase FUT8 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... and shRNA oligos for insertion (Table 1) were synthesized by GenScript. Oligos were reconstituted in water at a concentration of 100 μM ...
-
bioRxiv - Microbiology 2023Quote: Two plasmids (pMT-1 and pMT-2) were constructed by Genscript® using vector pUCP22.
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... with mouse-anti-FLAG-iFluor647 (1:500) (Genscript, Piscataway, NJ, USA) or anti-human IgG Fc Alexa Fluor 647 (1:200 ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit polyclonal anti-AQP4ex (1:2000; GenScript Biotech, Piscataway, NJ, USA), mouse monoclonal anti-OMP (1:1000 ...
-
bioRxiv - Microbiology 2024Quote: ... PCR fragment 1 was amplified from plasmid pUC57-re-ulg8 (GenScript) using primers 5’ box_F and 5’ box_R ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and 1 mM dithiothreitol) containing 50 units of PreScission protease (GenScript) was loaded on the column and incubated overnight at 4°C to cleave GST from fascin ...
-
bioRxiv - Neuroscience 2023Quote: ... in the middle of exon 2 was conjugated to KLH to improve antigenicity of the peptide sequence followed by polyclonal antibody production in rabbits (Genscript, Inc. Piscataway, NJ, USA). Anti-Bdwf antibody was affinity purified against the antigenic peptide and specificity was confirmed by immunohistochemistry analyses.
-
bioRxiv - Plant Biology 2020Quote: ... and probed with HRP-conjugated mouse anti-rabbit (1:10,000, Genscript, #A01856) and horse anti-mouse (1:5000 ...
-
bioRxiv - Cell Biology 2020Quote: ... Antagonist peptide 1 (SCSLFTCQNGIV) and 2 (SCSLFTCQNGGGWF) were chemically synthesized by Genscript. Anti-Mouse-IgG (H&L ...
-
bioRxiv - Molecular Biology 2020Quote: The E2-Crimson-human HSD11B1 gene (variant 1) was synthesised by GenScript in vector pUC57 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Tartan (Rabbit, 1:100, This study, GenScript, based on Full-length peptide). Donkey and Goat secondary antibodies conjugated to AlexaFluor488 ...
-
bioRxiv - Plant Biology 2022Quote: ... followed by secondary Goat Anti-Mouse IgG [HRP] (1:3000; A00160, Genscript). Proteins were detected with SuperSignal West Femto Maximum Sensitivity Substrate (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... Two commercially available ACE2-Fc proteins obtained from Genscript (Cat.No. Z03484-1) and Acrobiosystems (Cat.No ...
-
bioRxiv - Biochemistry 2022Quote: ... α-actinin-1 and myotilin derived peptides were obtained from Genscript (USA). For immunofluorescence imaging we used goat anti-human VPS35 (Abcam ...
-
bioRxiv - Immunology 2022Quote: ... were coated with S-2P protein 1 μg/mL (Genscript, Piscataway, NJ), RBD protein 1 μg/mL (Sino Biological ...
-
bioRxiv - Molecular Biology 2022Quote: ... pGEX4T-1-SUMO1-3 was designed by AJG and made by GenScript by cloning SUMO1-3 cDNA into BamHI and EcoR1 restriction sites ...
-
bioRxiv - Molecular Biology 2023Quote: ... pET-28a-6xHis-TEV-3xFLAG-ATP6V1H(1-351) was purchased commercially (GenScript). pFBDM-ATG7-ATG10-ATG12-StrepII2x-ATG5-ATG16L1 and pFDM-SH-SUMO*-Hrr25 were described previously (Schreiber et al. ...
-
bioRxiv - Microbiology 2024Quote: ... anti-EBV BALF0/1 rabbit mAb (generated by Genscript for this study), anti-EBV ZEBRA Mouse mAb (BZ1 ...
-
bioRxiv - Microbiology 2022Quote: ... and 1 µM DrkBiT peptide (VSGWALFKKIS, synthesized by GenScript at >95% purity) was then prepared and added to wells in triplicate on four white 96-well plates (Greiner Bio-One) ...
-
bioRxiv - Physiology 2023Quote: ... VSMCs were treated with either 1 ng/ml human TNFα (GenScript, Z00100) or 2.4 mM inorganic phosphate in the absence or presence of 0.1μM GSK2656157 (Cayman ...
-
bioRxiv - Biochemistry 2023Quote: ... gene blocks containing A5 fused with alternative purification tags (Genscript; Table 1) were inserted via standard cloning techniques and digested with NcoI and NotI (NEB ...
-
bioRxiv - Neuroscience 2023Quote: The spike peptides (Table 1) were custom ordered and synthesized by Genscript, Netherlands as previously described in Nyström et al 2022 (20) ...
-
bioRxiv - Developmental Biology 2024Quote: ... iFluor 555 or iFluor 647 conjugated Mouse anti-V5 (1:100, GenScript), Mouse anti-Flag (1:20,000 ...
-
bioRxiv - Microbiology 2024Quote: ... anti-RVFV nucleoprotein rabbit IgG (1:100 dilution; custom made via Genscript) was applied to each sample and incubated for 1 hour ...
-
bioRxiv - Pathology 2021Quote: ... Samples were mixed by vortexing and tested using the GenScript cPass™ SARS-CoV-2 Neutralization Antibody Detection Kit (GenScript USA, Inc. Piscataway, NJ, USA) according to the manufacturer’s protocol.
-
bioRxiv - Developmental Biology 2020Quote: vash-1 full length cDNA (EMSEMBL ENSDART00000143819.3) was designed and synthesised by GenScript. TA overhangs were added by incubating the insert for 10 min at 72 °C with 50mM DNTPs and Taq polymerase (NEB) ...
-
bioRxiv - Immunology 2022Quote: ... and 1 μg of vesicular stomatitis virus-G glycoprotein expressing plasmid pMDG (Genscript) using Fugene 6 transfection reagent (Promega ...
-
bioRxiv - Genetics 2022Quote: ... rabbit anti-OLLAS tag pre-absorbed against untagged animals 1:150 (Genscript, #A01658), mouse anti-FLAG pre-absorbed against untagged animals 1:400 (Sigma, ...
-
bioRxiv - Microbiology 2022Quote: ... A total of 120 peptides (Table 1) were produced by Genscript (Piscataway, NJ). Upon receipt ...
-
bioRxiv - Bioengineering 2022Quote: ... Peptides for zinpyr-1 competition binding assay were synthesized by GenScript (Piscataway, NJ). Reagents for making competent E.coli cells were obtained from Zymo Research (Irvine ...
-
bioRxiv - Physiology 2021Quote: The sequence encoding mouse like-acetylglucosaminyltransferase-1 (Large1) was synthesized (Genscript, Piscataway, NJ) and cloned into the AAV backbone under the transcriptional control of the ubiquitous CMV promoter ...
-
bioRxiv - Immunology 2022Quote: ... then 3.5μL of 1 mg/ml normal mouse IgG (mIgG) (GenScript, Cat# A01007) was added ...
-
bioRxiv - Physiology 2021Quote: ... PC-1 and PC-2 coiled-coil domain peptides were custom-made (Genscript). PC-1 or PC-2 peptides were added to pipette solution immediately before use at a final concentration of 1 μM ...
-
bioRxiv - Microbiology 2022Quote: The SARS-CoV-2 Wuhan-Hu-1 RBD construct was synthesized by GenScript into pcDNA3.1-with an N-terminal mu-phosphatase signal peptide and a C-terminal octa-histidine tag ...
-
bioRxiv - Biochemistry 2022Quote: The sequence encoding mouse like-acetylglucosaminyltransferase-1 (Large1) was synthesized (Genscript, Piscataway, NJ) and cloned into the AAV backbone under the transcriptional control of the ubiquitous CMV promoter ...
-
bioRxiv - Biochemistry 2022Quote: ... The sequence encoding mouse like-acetylglucosaminyltransferase-1 (Large1) was synthesized (Genscript, Piscataway, NJ) and cloned into the AAV backbone under the transcriptional control of the muscle-specific MCK promoter (gift from Jeff Chamberlain) ...
-
bioRxiv - Immunology 2022Quote: His tag-IP was performed using anti-His affinity resin (GenScript L00439-1) and Myc tag-IP was performed using anti-Myc affinity resin ...
-
bioRxiv - Immunology 2023Quote: ... and 1 μg of vesicular stomatitis virus-G glycoprotein expressing plasmid pMDG (Genscript) using Fugene 6 transfection reagent (Promega ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 dish per sample) were transfected with FLAG-GFP and FLAG-SF3B2 (GenScript) (14 µg DNA per dish ...
-
bioRxiv - Neuroscience 2024Quote: ... for fly protein samples or 2G7D4 (GenScript, Piscataway, NJ, USA; Mouse; 1:2,000) for mouse protein samples ...
-
bioRxiv - Immunology 2024Quote: ... Cells were pulsed with 1 µg/mL SIINFEKL peptide (Genscript, Piscataway, NJ, USA) for 1 h at 37 °C prior to use as targets for mouse OTI CTLs.
-
bioRxiv - Cancer Biology 2024Quote: ... immature BMDCs were harvested and loaded with 1 μg/ml OVA257-264 (GenScript), B16-OVA-Ogt+/+ and B16-OVA-Ogt−/− cells supernatant at 37°C for 6 h ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µL of competence specific peptide (1 mg/mL, DLRGVPNPWGWIFGR, synthetized by GenScript) and 1-5 µL of linear double-stranded DNA PCR product were mixed in a microcentrifuge tube ...
-
CRISPR-based environmental biosurveillance assisted via artificial intelligence design of guide-RNAsbioRxiv - Molecular Biology 2024Quote: ... 1 µL of 10 µM reporter (poly-U5 or poly-U15, GenScript, custom), 0.96 µL of 10 µM forward primer (GenScript ...
-
bioRxiv - Microbiology 2024Quote: ... (30) using anti-OROV nucleoprotein IgG (1:100 dilution; custom made by Genscript). Primary delete and no infection controls were performed to identify non-specific binding of the secondary detection antibody or all reagents ...
-
bioRxiv - Bioengineering 2021Quote: ... Hydrogel precursor solution was prepared by incorporating thiolated RGD peptide (GCGYGRGDSPG, 1 mM, Genscript) to promote integrin-mediated cell adhesion and lithium acylphosphinate (LAP ...
-
O-GlcNAcylation reduces phase separation and aggregation of the EWS N-terminal low complexity regionbioRxiv - Biochemistry 2021Quote: ... residues 1-264 (N-terminal LCR; LCRN) was synthesized by GenScript (Piscataway, NJ, USA) with codon optimization for expression in Escherichia coli ...
-
bioRxiv - Neuroscience 2022Quote: ... we inserted the designed sgRNA to target exon-1 of Ezrin (TGGCTGGTTGGTGGCTCTGCGTGGGT) (Genscript: NM_001271663.1_T3). Finally ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Bipartite proteins were detected using the rabbit anti-mCherry (A00682, GenScript, 1:3000 diluted), the mouse anti-His (A00186 ...
-
bioRxiv - Immunology 2020Quote: HLA-A*0201-restricted MART-1 peptide ELAGIGILTV) was synthesized by GenScript (Nanjing, China). Peptide was stored at 10 mg/ml in 100% dimethyl sulfoxide (DMSO ...