Labshake search
Citations for GenScript :
701 - 750 of 771 citations for 8H INDENO 1 2 D THIAZOL 2 AMINE HYDROBROMIDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... The SARS-CoV-2 S ectodomain with hexapro mutations and P.1 spike mutations (L18F, T20N, P26S, D138Y, R190S, K417T, E484K, N501Y, D614G, H655Y, T1027I, and V1176F) was synthesised by GenScript into pCMVR with foldon ...
-
bioRxiv - Biochemistry 2022Quote: ... The hexahistidine tag and Sso7dmut were cleaved from HIV-1 IN by addition of his-tagged sortase and GGGC peptide (GenScript). The reaction was exposed to nickel resin to remove sortase and any residual uncleaved IN ...
-
bioRxiv - Biophysics 2022Quote: ... construct cloned in a pGEX-6P-1 vector with an N terminal GST-tag followed by a precision protease site was obtained from GenScript.
-
bioRxiv - Molecular Biology 2022Quote: ... and AALA mutant were produced as GST-fused proteins by cloning the encoding ORF sequences into the pGEX-6P-1 plasmid (GenScript).
-
bioRxiv - Immunology 2022Quote: ... This recombinant SmCI-1 was used to generate a rabbit anti-Sm-CI-1 polyclonal antibody using the Custom pAb service offered by Genscript.
-
bioRxiv - Immunology 2023Quote: Antibody binding was also assayed by flow cytometry using CHO-K1 and CHO-K1 Fut8 KO cells transfected with a human PD-1 plasmid (GenScript) by lipofectamine (Thermo Fisher Scientific) ...
-
bioRxiv - Biophysics 2023Quote: ... The anti-Scm3 antibodies were generated in rabbits against a recombinant Scm3 protein fragment (residues 1-28) of the protein by Genscript. The company provided affinity-purified antibodies that we validated by immunoprecipitating Scm3 from yeast strains with Scm3-V5 and confirming that the antibody recognized a protein of the correct molecular weight that was also recognized by α-V5 antibody (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... while the Copiagag antibodies were generated against a Copia peptide antigen (see Figure 1) by immunizing rabbits with the peptide LMVVKNSENQLADIC (GenScript).
-
bioRxiv - Synthetic Biology 2023Quote: ... This was then back diluted 1:10 into DMEM-FBS media used for growing LLC-sppIP cells or fresh media containing synthetic sppIP peptide (Genscript). Media from LLC-sppIP cells was collected after 24 h of growth in 96 well plates.
-
bioRxiv - Biophysics 2024Quote: ... TTR type was determined by transferring the gel contents to a 0.2 µm nitrocellulose membrane and probing with a primary antibody (1:1000) directed against the C-terminal region of the wild type TTR sequence (GenScript). Horseradish peroxidase-conjugated goat anti-rabbit IgG (Invitrogen ...
-
bioRxiv - Biophysics 2024Quote: ... The genes encoding for RepA(1-70)TitinX were constructed and cloned into the pET28a vector by Genscript (Piscataway, NJ). The total substrate lengths are 168 ...
-
bioRxiv - Biochemistry 2024Quote: ... and synthesized and cloned into the pET-DUET-1 vector with a C-terminal Tobacco Etch Virus (TEV) protease cleavage site (ENLYFQG) and hexahistidine tag (His6) (GenScript). The expression construct was transfected into E ...
-
bioRxiv - Microbiology 2023Quote: 8xHis-zz-TEV-mBICD2 (full-length or truncated 1-560) was codon optimized for expression in SF9 insect cells and synthesized by Genscript. The genes were subcloned into pFastBac using NEBuilder HiFi DNA assembly (NEB E2621S) ...
-
bioRxiv - Biochemistry 2024Quote: ... the RBD and subdomain-1 (RBD-SD1, residues 307-675) and human TMPRSS2 (residues 107-492, NCBI accession O15393) were obtained from Genscript. Cloning and mutagenesis of those genes were also performed by Genscript ...
-
bioRxiv - Biophysics 2023Quote: The codon optimized gene encoding full length human systemic RNAi-defective transmembrane family member 1 (hSIDT1) was synthesized by GenScript and was then cloned into the pEG BacMam expression vector to be expressed via baculoviral transduction in HEK293S GnTI− cells as a fusion protein containing a C-terminal GFP-Strep-tag-II for large scale protein expression [49] ...
-
bioRxiv - Developmental Biology 2024Quote: ... Transfer was done at 20 V for 1 hour buffer containing 25 mM Tris base and 25 mM Bicine (M00139, GenScript) supplemented with 10% absolute ethanol (20821.330 ...
-
bioRxiv - Immunology 2024Quote: ... 293F cells were transfected with plasmids containing Spike protein (ATUM plasmid pD2528-CMV with insert QHD43416.1) and Spike-2P protein (site-directed mutagenesis to generate the 2P mutation on the plasmid containing Spike protein, GenScript) by 293fectinTM transfection reagent (Gibco ...
-
bioRxiv - Immunology 2024Quote: ... spleen single cell suspensions were incubated for 4h at 37°C in the presence of gp33 peptide (1 µg/mL KAVYNFATC; Genscript), brefeldin A (5 µg/mL ...
-
bioRxiv - Microbiology 2024Quote: ... placed into the sample cell and titrated with 3.2–4.8 μl aliquots of 0.1–1 mM peptide solutions (purchased from GenScript, Piscataway, NJ, USA), 2 mM SAM or 250 µM SAH ...
-
bioRxiv - Microbiology 2020Quote: ... the recombinant protein of the extracellular domain of human ACE2 (aa 1-740) fused to Fc (ACE2-Fc, Genscript, Nanjing, China) was coated on 96-well microtiter plate (50 ng/well ...
-
bioRxiv - Biophysics 2021Quote: ... at C-terminal was cloned into pGEX-6P-1 vector at BamHI and XhoI sites using gene synthesis and cloning services (GenScript, USA). The plasmid was transformed into E ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... rosetta synaptobrevin a codon-optimised nucleotide sequence encoding the soluble portion of the protein [Syb (1-75)] was prepared by gene synthesis (Genscript, USA): GAGGCGAACCGTACCGGTGACTACCGTCTGCAGGAAGCGCAGCGTCAAGTGGGCGAAGTT CAAAACGTGATGCGTGATAACCTGACCAAGGTTATCGAGCGTGGTGAAAAACTGGACGATC TGGACGCGAAGGCGGAAGATCTGGAGGCGGAGGGTCAGCGTTTCCAAAACCGTGCGGGCC GTCTGCGTCGTCAGATGTGGTGGCAAAACAAACGTAACCAGTAA
-
bioRxiv - Cell Biology 2020Quote: ... consensus sequence was obtained from RepeatMasker and/or from repbase (http://www.repeatmasker.org/) synthetized and cloned into pUC57 by GenScript (Supplementary Table 1). To make the IAPEz reporter (pTCH1) ...
-
bioRxiv - Cell Biology 2021Quote: ... were transfected with individual shRNA in pLKO.1 (Broad Institute, Cambridge, MA) mixed with packaging plasmid pCMV-dR8.91 (G193486, GenScript, Piscataway, NJ) and envelope plasmid pVSV-G (G178153 ...
-
bioRxiv - Immunology 2021Quote: ... and beta (1-244) chains were synthesized and cloned into the bacterial expression vector pET30a via NdeI and XhoI (Genscript, USA). Proteins were expressed as inclusion bodies in BL21 (DE3 ...
-
bioRxiv - Cell Biology 2020Quote: ... and for generation of EGFP-C2-Arp3B plasmid, the mRNA transcript variant 1 encoding murine actin-related protein 3B (Actr3b) (Jay et al., 2000) was synthesized (GenScript Biotech) and cloned into pEGFP-C2 vector (Clontech).
-
bioRxiv - Immunology 2021Quote: ... The wells were washed six times with PBS-T and incubated with 100 µL (1:10000) of Goat Anti Mouse IgG (Genscript, USA) or Anti Hamster IgG (Abcam ...
-
bioRxiv - Plant Biology 2020Quote: ... 1.5 μg of MEA or 1.5 μg of CLF (PRC2) complexes were incubated with 1 μg of Histone H3 peptides (GenScript, Piscataway, NJ) and 1.5 μCi of 3H-SAM (Perkin Elmer ...
-
bioRxiv - Cell Biology 2019Quote: ... 1:5,000 dilution) overnight at 4⍰°C followed by 11h incubation with anti-rabbit IgG secondary antibody (Genscript, catalog number. A00098) at room temperature ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lamin-C was overproduced and purified from codon-optimized Lamin-C (amino acid residues 1-152) engineered into pRSF-Duet plasmid (Genscript Inc.). The construct carries a tandem N-terminal Strep-tag ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Mammalian plasmid pcDNA3.1(+)-pHluorin was made by synthesizing and cloning a codon optimized sequence of pHluorin into the pcDNA3.1(+) backbone (GenScript; Piscataway, NJ).
-
bioRxiv - Biochemistry 2022Quote: ... The gene sequences for the PDZ domain of human PDLIM7 (1-84) and various point mutants were synthesised as codon optimised constructs and cloned into pET30b(+) by Genscript (USA) for bacterial expression with an N-terminal 6His-tag.
-
bioRxiv - Cancer Biology 2022Quote: ... SdAb detection was performed using (1:20000) MonoRab™ Rabbit Anti-Camelid VHH Antibody conjugated to HRP (GenScript, Cat. # A01861-200) in MTBST 0.05% ...
-
bioRxiv - Microbiology 2022Quote: ... the chromatography column was resuspended with 1 ml TCB as well as 20 μl (200 U) of TE protease enzyme (Genscript, Inc) on a rotator and the columns incubated at 4°C for 16 hours ...
-
bioRxiv - Neuroscience 2022Quote: We generated the UAS-syt1GCaMP6F construct by cloning the cDNA sequence of Drosophila synaptotagmin 1, a 3x GS linker, and the GCaMP6F sequence into the pJFRC7-20XUAS vector (Pfeiffer et al., 2010) (Genscript Biotech). The GS linker connects the C-terminus of syt1 to the N-terminus of GCaMP6F (after Cohn et al. ...
-
bioRxiv - Immunology 2023Quote: DNA encoding for residues 24-167 of the extracellular portion of human PD-1 (UniProt Q15116) with a C-terminus histidine tag or corresponding PD-1 N58Q mutant were cloned into pcDNA3.4 by GenScript (Piscataway, NJ). Expi293 cells were transiently transfected with plasmid DNA mixed with PEI (Polysciences ...
-
bioRxiv - Microbiology 2023Quote: ... The solution was replaced with blocking buffer with appropriate dilutions of primary antibody (1:500 Rabbit anti-ChmC (Genscript, custom-generated) or 1:2,000 Rabbit anti-OmpA ...
-
bioRxiv - Synthetic Biology 2023Quote: ... cultures were diluted 50-fold by transfer to 200 µL volumes comprising a 10-fold dilution series of ɑ-factor (0- 1 µM) (GenScript) in SC+1%DMSO ...
-
bioRxiv - Immunology 2024Quote: ... Heat 500 μl of mouse serumat 56℃ and then incubated the heated serum with 1 ml of washed Protein-G resin (GenScript L00209) overnight at 4°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... The fusion protein MBP-Hyx 1-176 was purified and injected into guinea pigs and the antibodies generated were purified by GenScript (Hong Kong).
-
bioRxiv - Immunology 2019Quote: Peptides (Table 1) and HLA-A*11:01-restricted KRAS G12V8-16 (VVGAVGVGK) as positive peptide were synthesized from GenScript (Nanjing, China), with purity greater than 98% by mass spectroscopy ...
-
bioRxiv - Biochemistry 2020Quote: A human Kif15 motor domain and neck linker construct (Kif15_MD residues 1-375) in a pET21a vector with a C-terminal 6 x His-tag was generated by chemical synthesis (GenScript, Piscataway, NJ). Six of the eight cysteine residues (C5S ...
-
bioRxiv - Biophysics 2019Quote: ... or s-(residues 195-960) OPA1 (UniProt O60313-1) were codon optimized for expression in Pichia pastoris and synthesized by GenScript (NJ, USA). The sequences encode Twin-Strep-tag ...
-
bioRxiv - Biophysics 2021Quote: ... Human l-Opa1 (isoform 1) and s-Opa1 with Twin-strep-tag at N-terminus and deca-histindine tag at C-terminus (GenScript, NJ, USA) was expressed in Pichia pastoris strain SMD1163 ...
-
bioRxiv - Biochemistry 2022Quote: ... The lysate was run on separate 12% SDS–polyacrylamide gel and probed using βarr antibody and HRP-coupled protein L antibody (dilution-1:2,000; GenScript; cat. No. M00098) by western blotting ...
-
bioRxiv - Molecular Biology 2020Quote: ... HRAS and NRAS gene sequences (residues 1–166, with an N-terminal His-tag and C-terminal BAP-tag were synthesized by GenScript (Piscataway, USA) and cloned into pET11a ...
-
bioRxiv - Cell Biology 2019Quote: Protease-activated receptor 1 (PAR-1)-activating peptide (TFLLRNPNDK-NH2) was custom synthesized as the C-terminal amide with a purity of > 95% by Genscript (Piscataway, NJ). Scrambled-siRNA (Sc-siRNA ...
-
bioRxiv - Microbiology 2020Quote: A synthetic gene encoding an human ACE2 fragment (residues 1-615) fused with a C-terminal 6xHis tag was generated by GenScript (Piscataway, NJ) and cloned into pCMV-IRES-puro expression vector (Codex BioSolutions ...
-
bioRxiv - Microbiology 2021Quote: ... of the SARS CoV2 isolate Wuhan-hu-1 genome (Genbank: NC_045512) were commercially synthesized and cloned into pUC57 vector (Genscript, New Jersey, USA). RNA motif plasmid cloning backbone [(pRMB ...
-
bioRxiv - Microbiology 2023Quote: ... A total of 5 peptides matching inoculum sequences for both the WT and SS14-DCKO strains (Table 3, labelled with a superscripted “1”) were produced by Genscript (Piscataway, NJ). Upon reception ...