Labshake search
Citations for GenScript :
701 - 750 of 1163 citations for 2 5 Sulfanyl 4H 1 2 4 triazol 3 yl phenol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... The resin was washed with 60 mL of buffer A supplemented with 2 mM CaCl2 and the bound protein was eluted from the column with 10 mL of buffer A supplemented with 5 mM EDTA and 0.2 mg/mL FLAG peptide (Genscript).
-
bioRxiv - Cell Biology 2024Quote: ... α-factor was added to the cells to a final concentration of 5 ng/ml α-factor (GenScript RP01002) for 3 hours ...
-
bioRxiv - Immunology 2023Quote: ... 5×105 cells per well (6 well plate) were stimulated with 100 ng/mL of IFN-γ (Z02916, Genscript) for 0 h ...
-
bioRxiv - Immunology 2022Quote: ... KIR-CD3ζ JNL cells were also incubated with parental 721.221 cells as negative control and with anti-Flag-tag (5 µg/ml) (clone 5A8E5, GenScript) and goat anti-mouse (10 µg/ml ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were treated with 5 μM of recombinant (PR)20 peptides (with a C-terminal HA epitope tag, Genscript) for 10 days ...
-
bioRxiv - Molecular Biology 2022Quote: ... The pL7-PfSMC3-3HA-glmS plasmid also contained the homology repair construct 5’- AGATAGAGAGAGTTATATATCTAAAGGAACAAAGAATGAGGCCTACGAAATTATTAGC ATTGTATAAAAAAAAAAAGAAAAAAAAAAGAAAAAAAAAAAAGATTATATATATAAT ATATGTTGACAATTAATAAATATATTTGTATATATCTGTTAACTAATTATGAAAATTTTT GAATCAATAAATTTTTTAAATAACAAAAAAAAAAAAAAATATATATATTATATATATA TTTTATATTTTATATTTTCTTGTAATTTTTGTTTTTTTAGGAGGAAAAACATGCCCTAGA AAATggcggtggaTACCCTTACGATGTGCCTGATTACGCGTAtCCcTAtGAcGTaCCaGAcTAtG CGTACCCtTAtGAcGTtCCgGATTAtGCtcacggggtgTAAGCGGCCGCGGTCTTGTTCTTATTTT CTCAATAGGAAAAGAAGACGGGATTATTGCTTTACCTATAATTATAGCGCCCGAACTA AGCGCCCGGAAAAAGGCTTAGTTGACGAGGATGGAGGTTATCGAATTTTCGGCGGATG CCTCCCGGCTGAGTGTGCAGATCACAGCCGTAAGGATTTCTTCAAACCAAGGGGGTGA CTCCTTGAACAAAGAGAAATCACATGATCTTCCAAAAAACATGTAGGAGGGGACAACA ATTTGGTTTTGTTTTTTTCTTTAGGTTTTGAGAAAAACAAATAGGAAATACAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAATGTATTTTTACATATGCACTTGGATTA TTTTATTTTTATTATTTTTCTTTATATAAAGTAAAAATATACATAAGTATGCTTATTTATT ACATAAGAGTTTATTTAAGAAAGGTTTCTTTTTCATAATATTGTGTGCATGAGTTTTTTT TTATTTTATTTTTTTTTTTTATTTCTGTAACGAAAAGGATATTAAAAAAAATAATAAAA- 3’ (synthesized by GenScript Biotech [Piscataway, NJ, USA]). This homology repair construct comprises a 3 x Hemaglutinin (3HA ...
-
bioRxiv - Neuroscience 2021Quote: ... plko.1-CMV.Puro-tGFP-shFoxg1 or plko.1-CMV.Puro-tGFP-shLuciferase (Genscript) plasmids ...
-
bioRxiv - Microbiology 2022Quote: ... The samples were heated for 10 min at 100°C and were then loaded on an SDS gradient gel (4–20% Precast Protein Improve Gels, Genscript Biotech Corporation). The gel was run for 120 min at 120 V ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... the same amount of whole cell proteins extracted from a positive sample and a control sample were individually boiled with the gel-loading buffer (4×LDS, Genscript, Nanjing, China), and loaded onto a 4 – 12% gradient SDS-PAGE gel (Genscript ...
-
bioRxiv - Plant Biology 2023Quote: ... Membranes were incubated with primary antibody for one hour (α-CLuc; Santa-Cruz Biotech) at room temperature or overnight at 4°C (α-His; GenScript), followed by washes with TBS-T ...
-
bioRxiv - Biochemistry 2024Quote: Codon optimized sequences of NAPstar3b and HyPer7 for expression in mammalian cells were commercially synthesized (Supplementary Table 4) (GenScript Biotech, Rijswijk, Netherlands) and delivered in pcDNA3.1(+ ...
-
bioRxiv - Bioengineering 2023Quote: ... and KLF4 from a polycistronic transcript (TRE3-OSK) and second construct encoding rtTA version 4 driven by hEf1a promoter (hEf1a-rtTA4) were generated by Genscript (Piscataway, NJ) as reported previously (Lu et al. ...
-
bioRxiv - Cell Biology 2023Quote: Keratinocytes near confluency were extracted using 2X Laemmli Buffer.53 Samples were then loaded on a SurePAGE 4-12% Bis-Tris SDS-PAGE gel (Genscript, Piscataway, NJ) under denaturating conditions followed by protein transfer onto Immuno-Blot® PVDF Membranes (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2024Quote: Samples were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) on a 4-12% Bis-Tris protein gel (GenScript Cat#M00653) with MES running buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... 1:100 (A00487, Genscript). All secondary antibodies were purchased from Invitrogen and used at 1:700 and were Alexa Fluor-488 Donkey anti-rabbit (A21206) ...
-
bioRxiv - Immunology 2022Quote: ... β-Actin (GenScript, 1:15,000), T-bet (clone 4B10 Santa Cruz ...
-
bioRxiv - Immunology 2022Quote: ... β-actin (GenScript, 1:15,000), goat anti-mouse (Jackson Immunoresearch ...
-
bioRxiv - Biophysics 2024Quote: ... named EKAR-1 (GenScript). To create entry vectors ...
-
bioRxiv - Genomics 2022Quote: ... G1 synchronization was achieved by incubating 700 ml of exponentially growing (OD600 0.2) bar1 cells with a final concentration of 5 ng/ml of alpha-factor (GenScript RP01002) for 3 hours ...
-
bioRxiv - Neuroscience 2020Quote: ... The crRNA (0.1nmole) was first annealed with an equimolar amount of transactivating crRNA (tracrRNA) in 5 µl in the annealing buffer (GenScript) by heating at 95°C for 5 min followed by rapid chilling ...
-
bioRxiv - Microbiology 2021Quote: ... The plasmid pModProm1-TiR1-TY1-3DHFR (DNA sequence in Supplementary Table 5 was DNA synthetized and then cloned in pUC57 simple by Genscript. The chimeric construct was inserted within the UPRT locus ...
-
bioRxiv - Molecular Biology 2022Quote: ... The galanin-GAL1R-Gi complex was formed in membranes by the addition of 5 μM galanin peptide (synthesized by GenScript) and 25 mU/mL apyrase ...
-
bioRxiv - Microbiology 2022Quote: ... A sequence in which each CTD serine 5 residue was replaced by an alanine was ordered as synthetic gene (GenScript) and subcloned in place of the wild-type CTD sequence into the G2-CTD construct (G2-CTD-S5A) ...
-
bioRxiv - Biochemistry 2021Quote: ... The supernatant fraction was then incubated with 5 μg of the indicated antibodies and protein A-agarose beads (GenScript L00210) at 4°C on a nutator for 5 h ...
-
bioRxiv - Immunology 2021Quote: ... The plate were then washed with PBS once and then 200,000 splenocytes were added to each well and stimulated for 24 Hrs at 37°C in 5% CO2 with pool of 12-mer peptides (GenScript) at a concentration of 5.0 μg/well spanning the entire SARS-CoV-2 S protein along with Negative control (RPMI 1640 supplemented with 10% FBS and 1X antibiotic and positive control (Concanavalin A ...
-
bioRxiv - Microbiology 2024Quote: ... The CRISPR array extended with a BsrG1 restriction site at the 5’ end was synthesized in pUC19 (GenScript Biotech, Netherlands).
-
bioRxiv - Bioengineering 2023Quote: ... and Cellulose synthase 5 (CesA5) gene from moss (Physcomitrella patens) carrying a C-terminal dodeca-HIS-tag [23] was custom synthesized from GenScript and cloned into yeast expression vector pPICZA ...
-
bioRxiv - Cell Biology 2024Quote: ... containing 100 µl of MaSC medium (DMEM/F12 containing 5% FBS, 10 ng/ml EGF [Novoprotein, C029], 20 ng/ml FGF2 [GenScript, Z03116] ...
-
bioRxiv - Biochemistry 2020Quote: ... 1-932 and EAV nsp9 1-693 was synthesized with codon optimization (Genscript) and cloned into pFastBac with an N-terminal MG addition and C-terminal TEV protease site and two Strep tags ...
-
bioRxiv - Biophysics 2024Quote: The S-S309 antigen-antibody antibody complexes were electrophoresed on the 4-12% SurePAGE™ Bis-Tris gel (Genscript Biotech Corporation, Jiangsu, China). The proteins were visualized by One-Step Blue Stain (Biotium ...
-
bioRxiv - Microbiology 2024Quote: ... DEPQRETLKAIHYALN) and scrambled peptide (Scr; QEALKYNRAETPLDIH) were designed as described previously (4) and synthesized using solid phase Fmoc chemistry (Genscript, New Jersey, USA). The peptide ...
-
bioRxiv - Immunology 2024Quote: ... The binding of VHHs was next followed by a 30 min incubation at 4 °C with an anti-FLAG-iF647 antibody (A01811, Genscript, Piscataway, NJ, USA), diluted 1:500 ...
-
bioRxiv - Microbiology 2021Quote: ... Lysed cells were denatured with SDS at 95°C for 5 min and separated on an 10% SDS PAGE (SurePAGE Bis-Tris, 10×8, GenScript, M00666) at 200V for 30 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... After clearance by ultracentrifugation (45 min, 120,000 g) the lysates were incubated with either FLAG-antibody- coated beads (Genscript, L004332-5) or Strep-Tactin®XT 4Flow high capacity resin (IBA life sciences ...
-
bioRxiv - Biochemistry 2022Quote: Codon-optimized gene corresponding to 5 to 897 amino acids of KFDV NS5 with an N-terminal Hexa-histidine tag was synthesized (Genscript USA) and sub-cloned into pET-28a (+ ...
-
bioRxiv - Microbiology 2024Quote: ... Western blot membranes were probed with primary antibody (either 1:4000 rabbit anti-FLAG [Sigma Aldrich, St. Louis MO] or 1:4000 or 1:2000 mouse anti-StrepII [Genscript, Piscataway NJ]) for 1 hour at room temperature or overnight at 4°C and with secondary antibody (either 1:5000 goat anti-rabbit or anti-mouse respectively conjugated to horseradish peroxidase (HRP ...
-
bioRxiv - Developmental Biology 2024Quote: ... Rabbit polyclonal anti-IFET-1 and anti-CAR-1 antibodies were made by GenScript.
-
bioRxiv - Microbiology 2022Quote: ... α-CrPV-VP2 (1:1000, Genscript), α-CrPV-3C (1:1000 ...
-
bioRxiv - Immunology 2021Quote: ... S1 (GenScript, Cat # Z03485-1) and RBD (aa 319-591 ...
-
bioRxiv - Cell Biology 2020Quote: ... FLAG (A00187, GenScript (1:1,000)) ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:7,500 (GenScript, A01827-200) and ECL2 detection steps ...
-
bioRxiv - Microbiology 2023Quote: ... anti-His (1:4,000) (GenScript), anti-GFP (1:10,000 ...
-
bioRxiv - Biochemistry 2023Quote: ... Strep (Genscript A01732, 1: 5,000), c-myc (Invitrogen 13-2500 ...
-
bioRxiv - Bioengineering 2023Quote: ... 1 mM RGD peptide (GenScript) was added to the precursor solution ...
-
bioRxiv - Synthetic Biology 2022Quote: ... we transformed 4 μg of a dsDNA cassette carrying the full-length adk.d6 variant with 400 bp flanking genomic homology (constructed by GenScript USA Inc., Supplementary Table 4). Cells were grown in the presence of 200 μM bipA in 2×YT media throughout the entire procedure ...
-
bioRxiv - Neuroscience 2024Quote: ... A total of 20–50 μg of the protein lysate was loaded onto a polyacrylamide gel (SurePAGE™, Bis-Tris, 10×8, 4%–12%, GenScript, Piscataway, NJ, USA), and the separated proteins were transferred to a 0.45 µm polyvinylidene fluoride (PVDF ...
-
bioRxiv - Synthetic Biology 2022Quote: DNA chunks comprising ∼5-10 Kb of each megachunk were synthesized and sequence verified by Genscript (megachunks A-K and N-X), GeneArt (megachunks L ...
-
bioRxiv - Immunology 2020Quote: ... Test serum (1:100 dilution) or the mAb 5B7D7 (1 µg/ml) (GenScript, Piscataway, NJ) was diluted in CSA buffer and incubated for 1 hour at room temperature with 0.1 µg/mL RBD-Fc (BPS Bioscience ...
-
bioRxiv - Cell Biology 2022Quote: ... GRGDSPC peptide (1% w/v) (Genscript) was added to the solution ...
-
bioRxiv - Molecular Biology 2020Quote: ... anti-GFP (1:1000) (GenScript, A01704) anti-MRG-1 (1:1000 ...