Labshake search
Citations for GenScript :
601 - 650 of 747 citations for T Cell Surface Glycoprotein CD3 Gamma Chain CD3G Antibody Biotin since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... The membranes were then incubated overnight at 4 °C in PBST with polyclonal rabbit antibodies raised against mcrA (1:10000 dilution) (GenScript, Piscataway, NJ, USA), washed four times for five minutes in PBST ...
-
Mammalian-unique eIF4E2 maintains GSK3β proline kinase activity to resist senescence against hypoxiabioRxiv - Cell Biology 2020Quote: ... HCT116 cells were cotransfected with plasmid pX330 and cas9 Nuclease (GenScript, Z03386-50) containing sgRNAs targeting exon 7 of eIF4E2-201 ...
-
bioRxiv - Immunology 2022Quote: ... The cDNA sequence synthesized and cloned into pcDNA3.4 for mammalian cell expression (GenScript).
-
bioRxiv - Genomics 2020Quote: Genomic DNA from the HEK293 cell line was purchased from GenScript (https://www.genscript.com).xs
-
bioRxiv - Immunology 2021Quote: ... cells were stimulated ex vivo with 5 μg/mL OVA257-264 peptide (GenScript) for 4 hours in the presence of Golgi stop (BD Biosciences ...
-
bioRxiv - Biochemistry 2021Quote: The human Sgk3 gene was codon optimized for expression in insect cells (Genscript) and fused to the C-terminus of His10/StrepII-tagged eGFP (A206K monomeric variant ...
-
bioRxiv - Microbiology 2021Quote: Gene synthesis for all insect cell codon optimized constructs was provided by Genscript. The original T ...
-
bioRxiv - Cancer Biology 2021Quote: DLD1 RNASEH2B-KO and 5637 RNASEH2B-KO cell lines were generated by GenScript USA ...
-
bioRxiv - Immunology 2021Quote: ... the variable genes were optimized for human cell expression and synthesized by GenScript. VH and VL were inserted separately into plasmids (gWiz or pcDNA3.4 ...
-
bioRxiv - Microbiology 2023Quote: Gene synthesis for all insect cell codon-optimized constructs was provided by GenScript. Both AP2 genes were cloned within the co-expression donor vector pFastBac dual which accepts two constructs ...
-
bioRxiv - Biochemistry 2021Quote: ... blots were washed thrice with TBST for 10min each and incubated with anti-rabbit HRP-coupled secondary antibody (Genscript, Cat. no. A00098, 1:2000) for 1 h ...
-
bioRxiv - Immunology 2022Quote: ... binding of SARS-CoV2 and control IgG antibodies (at 1 µg/ml) to 15-mer S2 overlapping 5-amino acid peptides (n=52, GenScript Biotech, 500 ng/well) was tested using the same procedure as previously described (Wardemann ...
-
bioRxiv - Immunology 2021Quote: ... the plates were washed with PBST four times followed by adding 100 µL 1:10,000 diluted HRP conjugated anti-human IgG antibodies (GenScript, Piscataway, NJ, USA; Cat # A00166) and incubating for 1 hour at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... in the middle of exon 2 was conjugated to KLH to improve antigenicity of the peptide sequence followed by polyclonal antibody production in rabbits (Genscript, Inc. Piscataway, NJ, USA). Anti-Bdwf antibody was affinity purified against the antigenic peptide and specificity was confirmed by immunohistochemistry analyses.
-
bioRxiv - Biochemistry 2020Quote: ... 293T cells were transiently transfected with plasmids expressing SARS-CoV-2 spike protein (GenScript MC_0101081 ...
-
bioRxiv - Immunology 2021Quote: ... Enriched B cells were stained with Flag tagged SARS-CoV-2 spike (Genscript, Z03481) then incubated with APC conjugated anti-Flag and PE conjugated anti-Flag for double staining ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were stimulated with synthetic SARS-CoV-2 S peptides pool (Genscript, Cat# RP30020) at the concentration of 2 μg/mL for 12 h and then incubated with 5 μg/mL Brefeldin A (MCE ...
-
bioRxiv - Cell Biology 2022Quote: ... MATα cells were verified by their lack of response to alpha factor (αF, Genscript) and by their ability to mate with MATa cells ...
-
bioRxiv - Cancer Biology 2023Quote: ... The PAR sensor cell line was generated by cloning the APLF cDNA sequence (Genscript) into the pHR-FUSN-mCh-CRY2WT plasmid (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transfected with the recombinant plasmid carrying the human TDP1 gene (GenScript, OHU22350D) using PEI transfection reagent as previously described (Popovic et al. ...
-
bioRxiv - Bioengineering 2023Quote: ... Cell adhesion was enabled through the incorporation of 1 mM RGD peptide (GCGTGRGDSPG, Genscript) in all hydrogel groups.
-
bioRxiv - Biochemistry 2023Quote: HeLa cells were lentiviral transduced with pLentiCRISPRv2 P-Rex1 guide RNA3 - AGGCATTCCTGCATCGCATC (Genscript SC1678). Forty-eight hours after transduction ...
-
bioRxiv - Pathology 2021Quote: ... Samples were mixed by vortexing and tested using the GenScript cPass™ SARS-CoV-2 Neutralization Antibody Detection Kit (GenScript USA, Inc. Piscataway, NJ, USA) according to the manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2021Quote: K562 cells expressing luciferase were transfected with a plasmid containing full-length EGFR (#OHu25437D, GenScript) using lipofectamine 2000 according to the manufacturer’s protocol (Invitrogen) ...
-
bioRxiv - Immunology 2022Quote: Both Ixodes IRE1α and TRAF2 were codon optimized for expression in human cell lines (GenScript). Primers listed in Supplemental Table 1 were used to amplify full length I ...
-
bioRxiv - Biochemistry 2021Quote: ... the cells were transfected with pcDNA3.1-spike-V5 with or without pcDNA3.1-GALNTs-FLAG (Genscript) using Lipofectamine 3000 reagent (Invitrogen ...
-
bioRxiv - Biochemistry 2022Quote: cDNA constructs for expression of recombinant Mac-1 in mammalian cells were generated by GenScript. ITGAM cDNA was cloned into the vector pcDNA3.1/HygroB(+) ...
-
bioRxiv - Biophysics 2022Quote: The mRBD (331-532) codon optimised for human cell expression was synthesized by GenScript (USA) (35) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Cells were arrested in G1 by addition of 10 µg/ml alpha factor peptide (Genscript) for 1.5 hrs ...
-
bioRxiv - Microbiology 2021Quote: LAD2 cells (3×105) were incubated with Spike-RBD protein (5 μg/mL, Genscript, Z03483) in adherent buffer (1mM CaCl2 ...
-
bioRxiv - Biochemistry 2022Quote: A batch of aE11 expressing hybridoma cells were sent to Genscript (GenScript Biotech [Netherlands] B.V.) for commercial Antibody Variable Domain Sequencing following their standard operating procedures ...
-
bioRxiv - Immunology 2023Quote: ... Lentiviral particles for spike transduction were generated by transfecting 293T cells with pMD2.G (Genscript), psPAX2 (Genscript ...
-
bioRxiv - Bioengineering 2023Quote: ... buffer at pH 9 was functionalized with a thiolated cell-adhesive RGD peptide (GenScript, GCGYGRGDSPG) via a Michael-type addition reaction ...
-
bioRxiv - Genomics 2023Quote: Cell lysates from HMLE shLuc and shM2 were separated by 4-20% SDS-PAGE (Genscript) and transferred to a PVDF membrane (10600023 GE) ...
-
bioRxiv - Bioengineering 2023Quote: ... dLN cells were restimulated in vitro in the presence of either OVA257-264 peptide (Genscript) at a final concentration of 1 mg/mL ...
-
Srs2 binding to PCNA and its sumoylation contribute to RPA antagonism during the DNA damage responsebioRxiv - Molecular Biology 2024Quote: Cells from log-phase cultures were treated with 5 μg/mL α factor (GenScript RP01002) for 1 h ...
-
bioRxiv - Immunology 2021Quote: ... chimeric group 1 or group 2 stalk proteins expressed in Sf9 cells were column purified (GenScript). For functional assays and luminex Fc receptor binding and titer ...
-
bioRxiv - Immunology 2020Quote: ... cell culture media were clarified by centrifugation and the IgG captured using Protein G resin (Genscript). IgG were eluted from the resin using 100 mM glycine pH 3.0 ...
-
bioRxiv - Immunology 2022Quote: ... The cells were cultured for 24 hours prior to being treated with: Human IL11 (UniProtKB:P20809, GenScript), human TGFβ1 (PHP143B ...
-
bioRxiv - Immunology 2022Quote: RMA-S/HLA-E cells were incubated with serial dilutions of peptides (3-300 μM, Genscript) in OptiMEM (ThermoFisher ...
-
bioRxiv - Immunology 2023Quote: For the comparation of OT-I cells activated with different concentrations of OVA257-264 (SIINFEKL, GenScript), OT-I splenocytes were activated with OVA257-264 (1 nM ...
-
bioRxiv - Immunology 2022Quote: ... cell culture media was clarified by centrifugation and the IgG captured using Protein G resin (Genscript). The IgG were eluted from the Protein G resin using 100 mM glycine pH 3.0 ...
-
bioRxiv - Neuroscience 2024Quote: ... 2000) was codon optimized for human cells and synthesized into a pcDNA 3.1(+) vector by Genscript. Codon-optimized G5A and Gqi5/9 sequences as well as cloning primers and further details are provided in Supplementary file 7.
-
bioRxiv - Molecular Biology 2020Quote: Specific treatment conditions were as follows: GPCR activation – Cells were treated with α-factor peptide hormone (Genscript) at 3μM final concentration ...
-
bioRxiv - Bioengineering 2021Quote: Recombinant human GILT-R37A-GAA protein was produced in HD Chinese hamster ovary cells and purified (Genscript). Cell culture supernatant was centrifuged ...
-
bioRxiv - Neuroscience 2021Quote: ... these cells were cultured in the presence of the OVA257-264 peptide (GenScript RP10611 or Sigma S7951). After 12 hours ...
-
bioRxiv - Cell Biology 2021Quote: ... exponential cells growing in YPDA medium were synchronized with 15 μg/ml α-factor (GenScript Cat. No:RP01002) for 2h at 25 °C ...
-
bioRxiv - Molecular Biology 2019Quote: ... Cells were transiently transfected with a pcDNA3.1 vector that expressed a C-terminally Flag-tagged AFG3L2 (GenScript) with the indicated single-point mutations ...
-
bioRxiv - Molecular Biology 2021Quote: ... The DROSHA knockout cell lines used were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were transfected with 500 nM P2RY2 (P2Y2RGD) or P2RY2D97E (P2Y2RGE) in pcDNA3.1 vector (Obtained from GenScript) or pcDNA3.1 alone (Empty vector ...