Labshake search
Citations for GenScript :
601 - 650 of 1179 citations for Mouse Anti Dengue Virus Pan Serotype NS1 Protein Antibody EA11 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... or corresponding species-appropriate IgG control antibody (GenScript), conjugated to Protein A Dynabeads (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: ... Recombinant antibody was cloned and produced by Genscript. Briefly ...
-
bioRxiv - Microbiology 2022Quote: ... THE V5 Tag Antibody (1:2000, GenScript Biotech) was used as primary antibody for samples and mouse anti-clathrin heavy chain clone 23 (1:2,000 ...
-
bioRxiv - Plant Biology 2022Quote: ... specific rabbit His-tag antibody (GenScript, A00174-40) or anti-monoubiquityl-histone H2B (Lys-120 ...
-
bioRxiv - Developmental Biology 2023Quote: Polyclonal antibodies were generated by Genscript (https://www.genscript.com/). The protein sequences used for each immunization were as follows ...
-
bioRxiv - Developmental Biology 2022Quote: ... immunization and antibody purification were performed by Genscript Biotech Corporation (Piscataway ...
-
bioRxiv - Bioengineering 2023Quote: ... GenCRISPRLL SaCas9 Antibody 26H10 (GenScript, #A01952, Piscataway, NJ), and Anti-Adeno-associated Virus 9 Antibody clone HL2374 (Millipore Sigma ...
-
bioRxiv - Physiology 2021Quote: The sequence encoding mouse like-acetylglucosaminyltransferase-1 (Large1) was synthesized (Genscript, Piscataway, NJ) and cloned into the AAV backbone under the transcriptional control of the ubiquitous CMV promoter ...
-
bioRxiv - Immunology 2022Quote: ... then 3.5μL of 1 mg/ml normal mouse IgG (mIgG) (GenScript, Cat# A01007) was added ...
-
bioRxiv - Biochemistry 2022Quote: The sequence encoding mouse like-acetylglucosaminyltransferase-1 (Large1) was synthesized (Genscript, Piscataway, NJ) and cloned into the AAV backbone under the transcriptional control of the ubiquitous CMV promoter ...
-
bioRxiv - Biochemistry 2022Quote: ... The sequence encoding mouse like-acetylglucosaminyltransferase-1 (Large1) was synthesized (Genscript, Piscataway, NJ) and cloned into the AAV backbone under the transcriptional control of the muscle-specific MCK promoter (gift from Jeff Chamberlain) ...
-
bioRxiv - Biophysics 2023Quote: ... human/mouse codon-optimized genes coding for the identified ChRs were ordered (GenScript, Piscataway ...
-
bioRxiv - Biochemistry 2023Quote: Sequences encoding mouse WT and site-mutated DAG1 were synthesized (GenScript, Piscataway, NJ) and cloned into adeno-associated virus 2/9 (AAV2/9 ...
-
bioRxiv - Plant Biology 2021Quote: ... Anti-SUMO (GenScript: A01693) and anti-GST (Abmart ...
-
bioRxiv - Biochemistry 2022Quote: ... anti-His tag (Genscript) or anti-FLAG (Genscript ...
-
bioRxiv - Biochemistry 2022Quote: ... or anti-FLAG (Genscript) antibodies ...
-
African Swine Fever Virus CD2v protein promotes β-Interferon expression and apoptosis in swine cellsbioRxiv - Microbiology 2020Quote: ... anti-Flag (A00187; Genscript) or anti-phosphorylated NF-κB (S536 ...
-
bioRxiv - Developmental Biology 2022Quote: ... rabbit anti Tbx20 (Genscript). Secondary antibodies were Alexa Fluor 488 goat anti-mouse IgG H+L (Thermo #A11001) ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-V5 from GenScript and anti-GFP from Santa Cruz Biotechnology ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were then incubated overnight at 4 °C with primary antibodies at 1:100 dilution in PBST and 1 % BSA [SARS-COV-2 Spike S1 antibody (#HC2001 GenScript - #A02038), p62 antibody (#BD 610832) ...
-
bioRxiv - Cell Biology 2019Quote: The proteins were codon optimized for eukaryotic expression and de novo synthesized by GenScript.
-
bioRxiv - Plant Biology 2019Quote: ... 1:500 (produced for this study using full length protein as antigen by GenScript); α-Actin ...
-
bioRxiv - Biochemistry 2020Quote: ... 293T cells were transiently transfected with plasmids expressing SARS-CoV-2 spike protein (GenScript MC_0101081 ...
-
bioRxiv - Neuroscience 2020Quote: ... SARS-CoV-2 Spike protein (S1 domain aa16-685, Cat# Z03485, Genscript, Piscataway, NJ) was added at concentrations ranging from 0.07 to 500 to nM ...
-
bioRxiv - Immunology 2020Quote: Plasmids encoding cDNAs for hMPV F proteins listed in Table S1 were synthesized (GenScript) and cloned into the pcDNA3.1+ vector ...
-
bioRxiv - Cell Biology 2021Quote: ... 25 μg protein from each sample was mixed with LDS Sample Buffer (M00676, GenScript) and loaded in each well of a 4-20% SurePAGE™ Bis-Tris gel (M00656 ...
-
bioRxiv - Bioengineering 2022Quote: We obtained the genes encoding the designed proteins in pET28a vectors from GenScript (Genscript.com). We confirmed the sequences of all the constructs by DNA sequencing (Eton bioscience ...
-
bioRxiv - Microbiology 2021Quote: ... All the proteins were endotoxin free (ToxinEraserTM Endotoxin Removal Kit, GenScript Biotechnology, Nanjing, China).
-
bioRxiv - Microbiology 2022Quote: ... 10^5 splenocytes were seeded and stimulated with peptides against S protein (From GenScript) (2μg/ml ...
-
bioRxiv - Microbiology 2021Quote: ... gene segment containing spike protein of SARS-CoV-2 wa s synthesized by GenScript Inc ...
-
bioRxiv - Immunology 2020Quote: ... ELISA plates were coated with 200 ng/well CoV2 RBD protein (GenScript; Cat: Z03483) overnight at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... fumigatus-optimized fluorescent protein mNeonGreen by using vector pSR25 (synthesized by GenScript, Piscataway, NJ). Primer pairs AtrR-CoNG MH F (CCCGGTCTTCGACACCA ATGGTCCACCCCACGGTGGATTGGCTGGTGCCGGTGCTGGT ...
-
bioRxiv - Biophysics 2022Quote: ... The fusion protein MBP-Q44-HttEx1 was subcloned into a pMalc2x plasmid by Genscript. The protein expression was done in Escherichia coli BL21(DE3 ...
-
bioRxiv - Microbiology 2023Quote: Full-length wMel WalE1 and wAna FtsZ protein-encoding constructs were synthesized by GenScript using codons optimized for E ...
-
bioRxiv - Cell Biology 2023Quote: ... DCP-Bio1-bound proteins were pulled down with Streptavidin-coated magnetic beads (Genscript #L00936) overnight at 4 °C following manufacturer’s protocol ...
-
bioRxiv - Genetics 2023Quote: ... MgR protein was purified by passing through a column Nickle resin (GenScript Biotech Co.) and washed by using 3 column volumes of wash buffer (50 mM Tris-HCl at pH 8.0 ...
-
bioRxiv - Microbiology 2023Quote: The full recombinant MPL36 protein (rMPL36/aa 41-321) was commercially produced by GenScript® Biotech with His-tag in an E ...
-
bioRxiv - Biochemistry 2024Quote: ... Digested product was bound to 500 µL of protein A resin beads (GenScript #L00210) overnight at 4℃ on a rotating shaker ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein samples were electroporated on 4-20% gradient SurePAGE™ Bis-Tris gel (Genscript) or 4-20% Tris-glycine gel (BioRad ...
-
bioRxiv - Microbiology 2024Quote: ... and synthetic fragments and genes encoding the fluorescent proteins from Genscript (Supplementary Table 2).
-
bioRxiv - Biochemistry 2022Quote: ... PVDF membranes were cut and immunoblotted with α-TatA and α-TatB antibodies respectively followed by HRP-conjugated α-rabbit antibody (GenScript). Proteins were visualized using ProSignal Pico ECL Western Blotting detection kit (Genesee Scientific).
-
bioRxiv - Microbiology 2020Quote: ... Primary polyclonal antibodies for Cfp29 were generated by GenScript USA Inc via immunization of rabbits with three peptides from the protein sequence ...
-
bioRxiv - Microbiology 2021Quote: ... and monoclonal antibody (clone ID: 6D11F2) were from GenScript® ...
-
bioRxiv - Molecular Biology 2023Quote: ... A custom RHINO polyclonal antibody was outsourced from GenScript using the recombinant protein described in the “Protein purification section” with 6xHIS tag retained and produced in rabbit (GenScript ...
-
bioRxiv - Plant Biology 2023Quote: Rabbit polyclonal antibodies were obtained from GenScript (NJ, USA). Epitopes were chosen based on the manufacturer’s prediction algorithm results in regions that were covered by the protein sequencing ...
-
bioRxiv - Biochemistry 2022Quote: ... Antibodies were custom-made by GenScript (New Jersey, USA), using the sequences provided in the Supplementary source data.
-
bioRxiv - Microbiology 2023Quote: ... rabbit immunization and antibody purification were conducted by Genscript Co ...
-
bioRxiv - Immunology 2023Quote: ... A SARS-Cov-2 neutralizing monoclonal antibody (GenScript #A02057) was used as a positive control at a starting concentration of 3.2 ng/µL ...
-
bioRxiv - Neuroscience 2023Quote: ... using the High-Affinity Antibody Purification Kit (L00404, GenScript) following the manufacturer’s protocol.
-
bioRxiv - Developmental Biology 2023Quote: The guinea pig Zfh1 antibody was generated by GenScript. Recombinant antigen consisting of amino acids 648-775 of Zfh1 isoform PB was produced with an N-terminal His-tag used for purification ...