Labshake search
Citations for GenScript :
601 - 650 of 896 citations for Mouse Anti Dengue Virus NS1 Serotype 3 Antibody CC6 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... rabbit polyclonal anti-BiP (1:600, GenScript) serum ...
-
bioRxiv - Developmental Biology 2022Quote: ... Anti-sera obtained from immunized rats (Genscript).
-
bioRxiv - Biophysics 2023Quote: ... purified using anti-Flag resins (GenScript Biotech), and further purified using Heparin and size-exclusion chromatography (Superose 6 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and Anti-LmGAPDH (dilution 1:2,000 - GenScript), followed by incubation with Anti-rabbit IgG (dilution 1:50,000 - BioRad ...
-
bioRxiv - Cell Biology 2024Quote: ... rabbit anti-pS1133WRN (Genscript-custom, 1:10000); rabbit anti-GST (Calbiochem ...
-
Molecular structure and conformation of stereocilia tip-links elucidated by cryo-electron tomographybioRxiv - Neuroscience 2021Quote: Rabbit polyclonal and monoclonal antibodies were generated using standard techniques by Genscript using the soluble PCDH15 EC1-EL extracellular region as the antigen ...
-
bioRxiv - Genomics 2020Quote: ... An antibody to CENH3 was custom-produced by GenScript (Piscataway, NJ, USA) against a peptide designed based on the C ...
-
bioRxiv - Bioengineering 2021Quote: Monoclonal antibodies against GAA and GILT-tag sequence were generated by Genscript. Mouse plasma samples were screened for the presence of GAA protein using JessTM ProteinSimple and following manufacturer’s protocol (ProteinSimple ...
-
bioRxiv - Microbiology 2021Quote: ... the cPass™ SARS-CoV-2 Neutralization Antibody Detection Kit (Genscript, L00847), was used as directed to detect antibodies that bind competitively to the receptor binding domain (RBD ...
-
bioRxiv - Biochemistry 2022Quote: The commercially available SARS-CoV-2 Neutralization Antibody Detection Kit (cPass, GenScript) was used to identify the presence of RBD neutralizing antibodies in the serum samples from mice immunized with r3CL-pro ...
-
bioRxiv - Microbiology 2022Quote: ... The polyclonal antibody against CrPV-1A in rabbits was generated by Genscript. USA.
-
bioRxiv - Immunology 2022Quote: ... A SARS-CoV-2 neutralizing monoclonal antibody (mAb; GenScript, Piscataway, NJ; #A02057), was used as a positive control at a known starting concentration of 3.2 ng/µL followed by serial 1:2 dilutions similarly to each sample and negative control ...
-
bioRxiv - Plant Biology 2019Quote: Polyclonal antibodies against Peptide-1 was raised in rabbit (GenScript, NJ, USA). Crude proteins from root tissues ...
-
bioRxiv - Molecular Biology 2021Quote: ... The purified protein was used for raising polyclonal antibodies in rabbits (Genscript). Optimal detection of SAP05 in phytoplasma-infected plants occurred at a 1:2,000 dilution of the antibody ...
-
bioRxiv - Microbiology 2022Quote: ... Antibodies against the SecY peptide MAKQPGLDFQSAKGGLGELKRRC were raised in rabbits by GenScript Biotech (Leiden ...
-
bioRxiv - Microbiology 2023Quote: Custom polyclonal antibodies specific for AmpC and OprD were generated by GenScript. The epitopes for each are listed in Supplemental file 2 ...
-
bioRxiv - Genomics 2022Quote: ... All ChIP-nexus experiments were performed using antibodies custom generated by Genscript: Zelda (aa 1117-1327) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Protein G Magnetic Beads were pre-incubated with V5 antibody (A01724, Genscript) for 4 h and crosslinked with 10 volumes of crosslinking buffer containing 20 mM DMP (3 mg DMP/ml of 0.2 M Boric Acid pH 9 ...
-
bioRxiv - Immunology 2023Quote: ... supernatants containing monoclonal antibodies were purified using Protein A magnetic beads (Genscript), and the purified samples were verified by SDS-PAGE.
-
bioRxiv - Genetics 2023Quote: ... scapularis Kenny custom antibody used in this study was generated by Genscript. Rabbits were immunized three times with 0.2 mg of tick Kenny immunogen (amino acids 223-356) ...
-
bioRxiv - Molecular Biology 2024Quote: Polyclonal rabbit antibodies against phopsho-TRF1 and TRF2 were generated by Genscript. Briefly ...
-
bioRxiv - Molecular Biology 2024Quote: ... Affinity-purified rabbit polyclonal antibodies specific to each eIF4E family member (Genscript) were used as the primary probe in western blotting ...
-
bioRxiv - Developmental Biology 2022Quote: ... Supernatants were incubated with 30 μL of PierceTM anti-HA magnetic beads (Thermo) or anti-DYKDDDDK IP resin (GenScript) at 4°C overnight ...
-
bioRxiv - Biochemistry 2024Quote: ... 0.04-0.32 picomoles of Tspan12-1D4 and 0.25-2 picomoles of 7xHis-MSP1D1 were probed by Rho anti-1D4 and THE anti-His (GenScript) antibodies respectively ...
-
bioRxiv - Neuroscience 2022Quote: Mouse voltage-gated sodium channel 5934 base pair-long genes (mSCN8AWT, mSCN8AK1425TAG, and mSCN8AK1546TAG were synthetized by GenScript (mSCN8A ...
-
bioRxiv - Immunology 2022Quote: ... The cells were allowed to adhere for 24 hours prior to treatment with mouse IL11 (UniProtKB: P47873, GenScript) or mouse TGFβ1 (R&D Systems ...
-
bioRxiv - Molecular Biology 2022Quote: ... The pL7-PfSMC3-3HA-glmS plasmid also contained the homology repair construct 5’- AGATAGAGAGAGTTATATATCTAAAGGAACAAAGAATGAGGCCTACGAAATTATTAGC ATTGTATAAAAAAAAAAAGAAAAAAAAAAGAAAAAAAAAAAAGATTATATATATAAT ATATGTTGACAATTAATAAATATATTTGTATATATCTGTTAACTAATTATGAAAATTTTT GAATCAATAAATTTTTTAAATAACAAAAAAAAAAAAAAATATATATATTATATATATA TTTTATATTTTATATTTTCTTGTAATTTTTGTTTTTTTAGGAGGAAAAACATGCCCTAGA AAATggcggtggaTACCCTTACGATGTGCCTGATTACGCGTAtCCcTAtGAcGTaCCaGAcTAtG CGTACCCtTAtGAcGTtCCgGATTAtGCtcacggggtgTAAGCGGCCGCGGTCTTGTTCTTATTTT CTCAATAGGAAAAGAAGACGGGATTATTGCTTTACCTATAATTATAGCGCCCGAACTA AGCGCCCGGAAAAAGGCTTAGTTGACGAGGATGGAGGTTATCGAATTTTCGGCGGATG CCTCCCGGCTGAGTGTGCAGATCACAGCCGTAAGGATTTCTTCAAACCAAGGGGGTGA CTCCTTGAACAAAGAGAAATCACATGATCTTCCAAAAAACATGTAGGAGGGGACAACA ATTTGGTTTTGTTTTTTTCTTTAGGTTTTGAGAAAAACAAATAGGAAATACAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAATGTATTTTTACATATGCACTTGGATTA TTTTATTTTTATTATTTTTCTTTATATAAAGTAAAAATATACATAAGTATGCTTATTTATT ACATAAGAGTTTATTTAAGAAAGGTTTCTTTTTCATAATATTGTGTGCATGAGTTTTTTT TTATTTTATTTTTTTTTTTTATTTCTGTAACGAAAAGGATATTAAAAAAAATAATAAAA- 3’ (synthesized by GenScript Biotech [Piscataway, NJ, USA]). This homology repair construct comprises a 3 x Hemaglutinin (3HA ...
-
bioRxiv - Genetics 2021Quote: ... rat anti-RAD-51 (1:500, (20)), guinea pig anti-SUN-1 S24pi (1:700, (72)), chicken anti-GFP (1:500, (A01694, Genscript)) ...
-
bioRxiv - Biochemistry 2024Quote: ... Purified EGF-like domain of NRG1ý or BTC was incubated with anti-DYKDDDDK G1 affinity resin (Genscript, short anti-Flag) for 1 hour at 4 °C and serially washed 3x with Buffer A (50 mM Tris-HCl pH 7.4 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and a rabbit polyclonal antibody specific for calmodulin-binding peptide (A00635-40, GenScript), a Goat anti-Rabbit IgG (H+L ...
-
bioRxiv - Cell Biology 2019Quote: ... Rat polyclonal antibodies against full-length recombinant GST-tagged PfAlba3 were from GenScript Corporation ...
-
bioRxiv - Microbiology 2021Quote: ... using primary antibodies specific for MeV F HRC (rabbit polyclonal, Genscript, 503028-1) and 6xHis tag (rabbit polyclonal ...
-
bioRxiv - Microbiology 2021Quote: ... using primary antibodies specific for MeV F HRC (rabbit polyclonal, Genscript, 503028-1) and 6xHis tag (rabbit polyclonal ...
-
bioRxiv - Microbiology 2020Quote: ... Custom primary peptide antibody generated in rabbits against ICP1 capsid (Gp122, YP_004251064.1) (GenScript) was diluted 1:1500 ...
-
bioRxiv - Bioengineering 2022Quote: ... 20D5 and 16A11 antibodies were extracted from the sequencing results provided by GenScript PROBIO ...
-
bioRxiv - Biophysics 2022Quote: ... for 2 minutes followed by 20 μM biotinylated FLAG-tag antibody (A01429, GenScript) for 30 minutes ...
-
bioRxiv - Immunology 2021Quote: ... Large-scale culture of supernatants and purification of antibodies was performed by Genscript.
-
bioRxiv - Molecular Biology 2020Quote: ... blocked with 5% milk and probed with C-Myc antibody (Genscript A00173-100), Rad53 antibody (Abcam ab104232) ...
-
bioRxiv - Biochemistry 2021Quote: ... The antibody variable domains of hybridomas 8E11 and 9C6 were sequenced by Genscript.
-
Development of monoclonal antibody-based blocking ELISA for detecting SARS-CoV-2 exposure in animalsbioRxiv - Microbiology 2023Quote: ... A cPass™ SARS-CoV-2 Neutralization Antibody Detection Kit (GenScript, Piscataway, NJ) was used and the test was performed following the instructions of the manufacture ...
-
bioRxiv - Genomics 2022Quote: ... Antibodies from each rabbit were purified and quantified individually (Genscript BioTech; Piscataway, NJ).
-
bioRxiv - Genetics 2023Quote: ... scapularis Relish monoclonal custom antibody used in this study was generated by Genscript. Mice were immunized three times with 0.2 mg of the tick N-Rel immunogen (Rel homology domain ...
-
bioRxiv - Bioengineering 2024Quote: ... GAPDH was detected using an antibody purchased from Cell Signaling (Cat#97166S) and ORF1 and ORF2 were detected using antibodies generated by GenScript. Finally ...
-
bioRxiv - Immunology 2021Quote: ... anti-DYKDDDDK (FLAG) tag-175Lu (clone 5A8E5, GenScript), VSVg tag-158Gd (rabbit pAb ...
-
bioRxiv - Developmental Biology 2021Quote: ... Guinea pig anti- Runt was made by GenScript using the full-length protein as an antigen ...
-
bioRxiv - Developmental Biology 2021Quote: ... and guinea pig anti-Runt (1:600; GenScript). Rhodamine-phalloidin (Invitrogen R415 ...
-
bioRxiv - Immunology 2021Quote: ... anti-NWSHPQFEK (NWS) tag-159Tb (clone 5A9F9, Genscript), anti-AU1-162Dy (clone AU1 ...
-
bioRxiv - Immunology 2021Quote: ... anti-Protein C tag-171Yb (clone HPC4, Genscript), anti-mCherry-142Nd (Abcam) ...
-
bioRxiv - Immunology 2021Quote: ... anti-Protein C tag-171Yb (clone HPC4, Genscript), anti-mCherry-142Nd (Abcam) ...
-
bioRxiv - Immunology 2021Quote: ... anti-NWSHPQFEK (NWS) tag-159Tb (clone 5A9F9, Genscript), anti-AU1-162Dy (clone AU1 ...