Labshake search
Citations for GenScript :
601 - 650 of 701 citations for Human CMTR2 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: Mammalian expression plasmids (pcDNA3.1+/C-(K)DYK) for HLA-DRA (NM_019111) and HLA-DRB1 (NM_001243965) were purchased from GenScript (Piscataway, NJ; USA). HEK293T/17 cells at sub-confluence in 6-well plates or 100 mm dishes were transfected with HLA-DRA plasmid or HLA-DRB1 plasmid or a 1:1 combination of both using the Lipofectamine 3000 transfection reagent (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... The HNF4A-targeting gRNA is from the genome-scale CRISPR knock-out (GeCKO) v2 library [106] (purchased as lentiviral plasmid from Genscript) and the FMR1-targeting gRNA from the Jaenisch lab was obtained from Addgene (pgRNA-CGG ...
-
bioRxiv - Biochemistry 2020Quote: ... The plasmid encoded an N-terminal 8X His-SUMO-tagged hNatD in the pET-21a vector was obtained from Genscript. Library of Pharmaceutically Active Compounds (LOPAC ...
-
bioRxiv - Microbiology 2020Quote: ... were synthetized and cloned in plasmid pSG1-RFP (between the AscI and NotI sites of the multiple cloning sites) by Genscript Corp ...
-
bioRxiv - Synthetic Biology 2021Quote: All gBlocks fragment containing 5 sgRNA expression cassettes with high fidelity four-base overhang pair2 after cutting with type IIS restriction enzyme BbsI restriction enzyme were designed and directly sent to be synthesized into PUC57 cloning plasmid by GenScript. Two oligos with BbsI cutting sites were annealed and cloned into backbone vector with CMV promoter drive fluorescent protein expression using SpeI-HF ...
-
Comparison of the neuraminidase antigenicity in recently circulating influenza A and vaccine virusesbioRxiv - Microbiology 2021Quote: ... The genes corresponding the NAs from the following strains were synthesized and inserted into the pHW2000 plasmid [47] by Genscript: A/H1N1/Guangdong-Maonan/SWL1536/2019 (N1-GD19) ...
-
bioRxiv - Systems Biology 2021Quote: ... The +1 nucleotide was mutated to all other nucleotides (G, C or T) and these 3 mutant plasmids were synthesized into DNA oligos and cloned by Genscript.
-
bioRxiv - Cell Biology 2021Quote: ... the base mNeon-pDM304 expression plasmid for N-terminal fusions was generated by restriction enzyme cloning a codon-optimized synthesized mNeon gene (GenScript) into the extrachromosomal expression plasmid pDM304 (Veltman et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... The base Scarlet I-pDM304 expression plasmid for C-terminal fusions was generated by restriction enzyme cloning a codon-optimized synthesized Scarlet I gene (GenScript) into the extrachromosomal expression plasmid pDM304 (Veltman et al. ...
-
bioRxiv - Biophysics 2021Quote: pET-DUET expression plasmids containing the genes for barnase and barstar under the control of their own T7 promoter were obtained from GenScript Biotech Corporation (Piscataway ...
-
bioRxiv - Biophysics 2021Quote: A plasmid expressing mature OmpA without the 22 amino acid signal sequence in the pET303 vector was purchased from Genscript for cloning of the modified loop constructs ...
-
bioRxiv - Bioengineering 2022Quote: ... knock-out was constructed by cloning a chloramphenicol marker to the pUC57 plasmid containing the sequences flanking acr1 (here named as pJL8, purchased from Genscript). The plasmid pJL10 was constructed by cloning the PT5-acr1-kanr cassette (Luo et al. ...
-
bioRxiv - Biochemistry 2022Quote: The gene encoding SARS-CoV-2 NSP3 Mac1 (residues 3-169) was cloned into a pET-22b(+) expression plasmid with a TEV-cleavable N-terminal 6-His tag (Genscript). The protein was expressed and purified as described previously (14).
-
bioRxiv - Immunology 2022Quote: ... Matched pairs of antibody VH and Vλ/Vκ sequences were commercially cloned into plasmids containing an IgG1 or relevant light chain backbone and expressed as recombinant antibody (Genscript). mAbs were also expressed in-house by transient transfection of Expi293 cells (Gibco ...
-
bioRxiv - Neuroscience 2020Quote: TDP-43 BiFC constructs: Synthesis and subcloning of the gene fragments into pCS2+ plasmids were performed by GenScript (NJ, USA). Wild-type human TDP-43 was N-terminally fused to either VN155 or CC155 via a (GGGS)3 flexible linker ...
-
bioRxiv - Microbiology 2021Quote: ... coli K-12 MG1655 thymidylate kinase alleles (WT, Q45P, and A69T) were amplified and cloned into the plasmid expression vector pRSFDuet-1 (GenScript). Expression is under control of the T7 lac promoter ...
-
bioRxiv - Molecular Biology 2022Quote: ... HeLa FJ-KO cells were transfected with the following plasmids: pMK204-TetOne AAVS1-MCS (+) Flag-tagged FANCJ WT or pMK240-TetOne AAVS1-MCS (+) Flag-tagged FANCJ-AALA (GenScript). The plasmid pMK240-TetOne AAVS1-MCS (+) ...
-
bioRxiv - Bioengineering 2019Quote: ... DNA sequences coding for HMG-box Pf and Hs were cloned into the plasmid pET-24c (+) (KanR) by GenScript (USA). The coding sequences of both domains were optimized for codon usage of the host (E ...
-
bioRxiv - Microbiology 2020Quote: ... stable GFP expression by GAS was created by synthesizing the ribosomal binding site (RBS) and gfp gene from pDCerm-GFP (Ly et al., 2014) into the pUC57 plasmid (GenScript), resulting in pUC57-RBSGFP plasmid ...
-
bioRxiv - Biophysics 2020Quote: The plasmid containing the catalytic domain of PKA (PKAc) was a gift from Susan Taylor via Addgene (#14921).13 The other plasmids were synthesized by Genscript and codon optimized for expression in E ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... SARS CoV-2 Mpro and PLpro expression plasmids pcDNA3.1 SARS2 Mpro and pcDNA3.1 SARS2 PLpro was ordered from Genscript (Piscataway NJ) with codon optimization.
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... The latter plasmid was generated by placing the following de novo synthesized V5-GAL4v-VP48-OLLAS (GAL4-VP48) sequence (Genscript) into EcoRV-digested pUC57 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... pSensor09 was constructed by amplifying the backbone plasmid p416TEF1 using primer pair pYDA05/20 and primer pair pYDA21/22 to amplify PTEF1-YAS3-TCYC1 (Genscript_003).
-
bioRxiv - Neuroscience 2019Quote: ... ZsGreen sequences were removed from the plasmid (HRI-HA Tet-On minZsGreen) leaving only HRI and HA inserted (constructs synthesized by GenScript). Codon-optimized versions were made in HRI-HA Tet-On minZsGreen plasmids using GenScript algorithms including optimization of the HA tag ...
-
bioRxiv - Immunology 2020Quote: ... plasmid that contained predesigned guide RNA targeting Adar1 (5’-CTTGTCCGTCAAGTACCAGA-3’) and a pLentiCRISPR v2 plasmid that contained predesigned guide RNA targeting Adar2 (5’-AGTACCGCCTGAAGAAGCGA-3’) were obtained from GenScript. These plasmids were then transfected into Raw 264.7 cells using a Neon Transfection System (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2021Quote: ... following published Current Protocols in Neuroscience.43 Plasmids for SARS-CoV-2 variants were synthesized using the prototype sequence (GenScript MC_0101081 ...
-
bioRxiv - Immunology 2021Quote: ... were derived from the Wuhan-Hu-1 strain genome sequence (GenBank MN9089473) and synthesized and subcloned into a CMVR plasmid by Genscript. RBD with VOC point mutations were generated using a modified QuikChange site-directed mutagenesis protocol (Agilent) ...
-
bioRxiv - Immunology 2020Quote: The SARS-CoV-2 pseudovirus was produced by co-transfection of HEK293T cells with 1:1 ratio of DNA plasmid encoding SARS-CoV-2 S protein (GenScript) and backbone plasmid pNL4-3.Luc.R-E-(NIH AIDS Reagent ...
-
bioRxiv - Molecular Biology 2021Quote: ... plasmid (Addgene plasmid #48138)62 containing a guide RNA (5’-ACTGAGCTTGGATGCTTCTG-3’) and a donor plasmid containing 700 bp homology arms and a RPAC1 tag synthesised by GenScript into pUC57-Mini plasmid ...
-
bioRxiv - Genetics 2022Quote: ... integration cassettes were constructed by replacing a spt5+ gene fragment (+2398 of the spt5 ORF to the stop codon) in the pUC19-based spt5CTD+-ura4-spt53’ plasmid (75) with synthetic DNA fragments (Genscript) harboring the relevant mutations ...
-
bioRxiv - Microbiology 2022Quote: ... The plasmids were generated by synthesis of Flex-mCherry and Flex-eGFP and inserted into humanized M plasmids described in [7] using EZcloning from Genscript. The SARS-CoV-2 N protein was tagged at the N-terminus ...
-
bioRxiv - Microbiology 2022Quote: ... and ZIKV (GenBank accession no. NC012532, UniProt accession no. Q32ZE1) were commercially synthesized and cloned into plasmid pUC57 by GenScript Biotech ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNA was synthesized in pcc1-pbrick plasmid between cauliflower mosaic virus promoter (CaMV) 35S promoter and CaMV PolyA terminator de novo by GenScript, Piscataway ...
-
bioRxiv - Molecular Biology 2022Quote: ... and AALA mutant were produced as GST-fused proteins by cloning the encoding ORF sequences into the pGEX-6P-1 plasmid (GenScript).
-
bioRxiv - Synthetic Biology 2022Quote: ... The designed construct was gene synthesized and cloned into the pCDF plasmid backbone using the Ncol and XhoI restriction sites added by Genscript with an alanine codon added after the first methionine in the signal peptide to ensure in-frame with the Ncol restriction site.
-
bioRxiv - Microbiology 2023Quote: ... XG014 and DXP-604 were produced by transfection of HD CHO-S cells with plasmids in a 30-ml volume (GenScript). Monoclonal IgA1 antibodies were produced in CHO cells transiently transfected with two plasmids expressing a heavy and light chain ...
-
bioRxiv - Neuroscience 2023Quote: ... the plasmid backbone was generated by EcoRI/HindIII restriction digestion of the K89/34 scFv originally generated to order by Genscript. These digestions were followed by heat inactivation of the enzymes by incubation at 80 °C for 20 min ...
-
bioRxiv - Neuroscience 2023Quote: ... The plasmid backbone was generated by EcoRI/HindIII restriction digestion of the N52A/42 scFv originally generated to order by Genscript. The second subset of scFvs were cloned into the pcDNA3.4 expression plasmid ...
-
bioRxiv - Cancer Biology 2023Quote: ... Knockout of β2m was performed using the pLentiCRISPR v2 CRISPR/Cas9 system37 using a pLentiCRISPR v2 plasmid encoding the β2m-targeting guide RNA (gRNA): GAGTAGCGCGAGCACAGCTA (Genscript). Lentiviral particles were packaged in HEK293T cells (ATCC ...
-
bioRxiv - Biophysics 2023Quote: ... or one with the GCN4 peptide (EELLSKNYHLENEVARLKK) were synthesized and subcloned into the pcDNA3.1-mGL-NLuc plasmid using BamHI-XhoI sites (GenScript, Singapore). For generating the picLg and picLg-GCN4 fragment expressing plasmids ...
-
bioRxiv - Cell Biology 2023Quote: The full length of TgREMIND DNA sequence and those of its N-terminus F-BAR and C-terminus REMIND domains were synthesized and cloned into the pGEX plasmid by GenScript using the restriction enzymes BamHI and NcoI ...
-
bioRxiv - Plant Biology 2023Quote: ... The plasmids pGEX-4T-1_CepuHY2 and pGEX-4T-1_NediHY2 were purchased as already cloned by GenScript (Piscataway, New Jersey, USA). The full list of employed constructs can be found in Supplemental Materials (Table S2).
-
bioRxiv - Biochemistry 2023Quote: ... T4-foldon trimerisation domain and ADAH11 spaced by glycine-serine linker sequences (Supplementary Table 6) was inserted into the pHEN6 plasmid (Genscript), expressed in T7 Express E ...
-
bioRxiv - Biophysics 2023Quote: ... nucleotide sequences encoding picALuc residues G23-C120 or with the GCN4 peptide were synthesized and subcloned into pcDNA3.1-mGL-NLuc plasmid using the HindIII-XhoI sites (GenScript, Singapore).
-
bioRxiv - Synthetic Biology 2023Quote: ... cells were transiently transfected with plasmids containing receptors of interest under eukaryotic expression promoters (ASGR1 was clone OHU03658D from GenScript), then split into 96-well plates (20,000 cells per well ...
-
bioRxiv - Molecular Biology 2023Quote: ... The pBY011 plasmid encoding yeast CHD1 gene under the GAL1/10 promoter was obtained from a DNASU plasmid repository and altered by GenScript, where FLAG tag and NES-NES sequences were added to the N- and C-termini of the gene ...
-
bioRxiv - Genetics 2023Quote: All assembly parts (consisting of fragments F1 to F12 designed in the previous protocol with appended Type IIS cut sites) were ordered as plasmids in a pUC57-mini BsaI-Free backbone from Genscript at a maxiprep scale (Supplementary Table 2) ...
-
bioRxiv - Molecular Biology 2023Quote: A DNA library (Supplementary Table 6, 7) comprising seven random nucleotides was created and subsequently cloned into the plasmid pUC18 by GenScript. This random library was transformed in XL1blue E ...
-
bioRxiv - Immunology 2024Quote: ... 293F cells were transfected with plasmids containing Spike protein (ATUM plasmid pD2528-CMV with insert QHD43416.1) and Spike-2P protein (site-directed mutagenesis to generate the 2P mutation on the plasmid containing Spike protein, GenScript) by 293fectinTM transfection reagent (Gibco ...
-
bioRxiv - Synthetic Biology 2024Quote: ... the T7 RNAPC (110-883 aa of T7 RNAP), and ZA/ZB fragments were synthesized and cloned into the plasmid pJM1B6 (Yuan, 2022) by GenScript Biotechnology (Nanjing ...