Labshake search
Citations for GenScript :
601 - 650 of 1012 citations for 2 1 1 Diethoxy 2 methyl propyl 4' Nitrophenyl Carbonate d6 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: Protein lysates were incubated with 1 µg mouse anti-V5 antibody (Genscript A01724) for 2 h at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... and 1 μg of vesicular stomatitis virus-G glycoprotein expressing plasmid pMDG (Genscript) using Fugene 6 transfection reagent (Promega ...
-
bioRxiv - Genomics 2023Quote: CUT&Tag was performed with mouse anti-HA antibodies (1:100, Genscript #A01244), rabbit anti-H3K4me3 antibodies (1:100 ...
-
bioRxiv - Immunology 2024Quote: ... Cells were pulsed with 1 µg/mL SIINFEKL peptide (Genscript, Piscataway, NJ, USA) for 1 h at 37 °C prior to use as targets for mouse OTI CTLs.
-
bioRxiv - Cancer Biology 2024Quote: ... immature BMDCs were harvested and loaded with 1 μg/ml OVA257-264 (GenScript), B16-OVA-Ogt+/+ and B16-OVA-Ogt−/− cells supernatant at 37°C for 6 h ...
-
bioRxiv - Microbiology 2024Quote: ... (30) using anti-OROV nucleoprotein IgG (1:100 dilution; custom made by Genscript). Primary delete and no infection controls were performed to identify non-specific binding of the secondary detection antibody or all reagents ...
-
bioRxiv - Neuroscience 2024Quote: ... for fly protein samples or 2G7D4 (GenScript, Piscataway, NJ, USA; Mouse; 1:2,000) for mouse protein samples ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 dish per sample) were transfected with FLAG-GFP and FLAG-SF3B2 (GenScript) (14 µg DNA per dish ...
-
CRISPR-based environmental biosurveillance assisted via artificial intelligence design of guide-RNAsbioRxiv - Molecular Biology 2024Quote: ... 1 µL of 10 µM reporter (poly-U5 or poly-U15, GenScript, custom), 0.96 µL of 10 µM forward primer (GenScript ...
-
bioRxiv - Plant Biology 2020Quote: ... coli (Supplementary Table 4) and synthesized by GenScript (Piscataway, NJ). The Arabidopsis THI4 sequence was the native cDNA ...
-
bioRxiv - Cell Biology 2020Quote: ... Polyacrylamide gel (SurePAGE™, 4-20%) was bought from Genscript Biosciences (Nanjing ...
-
bioRxiv - Microbiology 2022Quote: SDS-PAGE analyses were performed using 4-12% SurePAGE (Genscript), the precast mini polyacrylamide gels ...
-
bioRxiv - Neuroscience 2022Quote: ... The proteins were separated by 4-20% SDS-PAGE (GenScript) and transferred onto PVDF membranes(Amersham) ...
-
bioRxiv - Biophysics 2020Quote: ... and then resolved on 4%-20% Bis-Tris gels (GenScript). The gels were stained with Coomassie brilliant blue and imaged with Image Lab 3.0 (Bio-Rad).
-
bioRxiv - Cell Biology 2022Quote: ... Interleukin-4 (catalog #Z02996) was purchased from GenScript (Piscataway, NJ). Reduced glutathione (catalog #G6529 ...
-
bioRxiv - Biochemistry 2024Quote: ... SDS-PAGE (SurePAGE™, Bis-Tris, 10ξ8, 4-12%, GenScript) was used to assess protein purity ...
-
bioRxiv - Cell Biology 2024Quote: Proteins were separated on 4-12% SDS-PAGE gels (GenScript) and transferred to PVDF membrane (0.2 μm ...
-
bioRxiv - Microbiology 2024Quote: Samples were separated on 4-12% Bis-Tris gels (Genscript) in Tris-MOPS-SDS running buffer (Genscript M00138 ...
-
bioRxiv - Developmental Biology 2020Quote: ... A primary antibody specifically for zebrafish was used to detect Esco2 (1:1000, GenScript). Alexa 546 anti-rabbit (1:1000 ...
-
bioRxiv - Bioengineering 2021Quote: ... Hydrogel precursor solution was prepared by incorporating thiolated RGD peptide (GCGYGRGDSPG, 1 mM, Genscript) to promote integrin-mediated cell adhesion and lithium acylphosphinate (LAP ...
-
O-GlcNAcylation reduces phase separation and aggregation of the EWS N-terminal low complexity regionbioRxiv - Biochemistry 2021Quote: ... residues 1-264 (N-terminal LCR; LCRN) was synthesized by GenScript (Piscataway, NJ, USA) with codon optimization for expression in Escherichia coli ...
-
bioRxiv - Neuroscience 2022Quote: ... we inserted the designed sgRNA to target exon-1 of Ezrin (TGGCTGGTTGGTGGCTCTGCGTGGGT) (Genscript: NM_001271663.1_T3). Finally ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Bipartite proteins were detected using the rabbit anti-mCherry (A00682, GenScript, 1:3000 diluted), the mouse anti-His (A00186 ...
-
bioRxiv - Immunology 2020Quote: HLA-A*0201-restricted MART-1 peptide ELAGIGILTV) was synthesized by GenScript (Nanjing, China). Peptide was stored at 10 mg/ml in 100% dimethyl sulfoxide (DMSO ...
-
bioRxiv - Immunology 2020Quote: MART-1 originated peptide ELAGIGILTV (HLA-A*0201) was synthesized by GenScript (Nanjing, China) with a purity of ≥ 99.0% ...
-
bioRxiv - Molecular Biology 2022Quote: ... VHL 3KR-14-3-3ζ (1-230) 19KR K49E mutation were synthesized by GenScript Biotech ...
-
bioRxiv - Microbiology 2022Quote: ... The following antibodies were used: rabbit anti-GST (GenScript, A00097, 1:2000 for WB), rabbit anti-Flag (Sigma ...
-
bioRxiv - Cancer Biology 2024Quote: ... and diluted 1:5000 HRP-conjugated goat anti-rabbit IgG (cat no. A00098, GenScript) were used as secondary antibodies ...
-
bioRxiv - Microbiology 2022Quote: ... The following primary antibodies were used at 1:5000 dilution: anti-FLAG antibody (GenScript), and anti-GAPDH antibody (Proteintech) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Sequences were split into 1–1.5 kilobase fragments and ordered as GenParts from GenScript. Primers were ordered from QuintaraBio to amplify from the ends of each GenPart ...
-
bioRxiv - Molecular Biology 2023Quote: ... pcDNA3.1-C-FLAG containing human ATP6V1H transcript variant 1 (NM_015941.4) was purchased commercially (GenScript). pcDNA3.1-ATP6V1H(1-351)-FLAG ...
-
bioRxiv - Bioengineering 2023Quote: ... Cell adhesion was enabled through the incorporation of 1 mM RGD peptide (GCGTGRGDSPG, Genscript) in all hydrogel groups.
-
bioRxiv - Cancer Biology 2022Quote: FITC-CCNL1321-332 peptides (numbering according to Uniprot Q9UK58-1) were purchased from GenScript and FITC-cyclin E377-384 peptides (numbering according to Uniprot P24864-3 ...
-
bioRxiv - Immunology 2024Quote: ... Cells were then stimulated with 1 μM of test peptides (custom peptide synthesis, GenScript) or control reagents as indicated in each relevant figure legend and costimulatory antibodies anti-CD28 (BD Biosciences ...
-
bioRxiv - Immunology 2024Quote: ... Serum samples were diluted (1:10) and preincubated with 100 ng/ml RBDmFc (Genscript) in blocking buffer for 1 hour at room temperature ...
-
bioRxiv - Immunology 2024Quote: ... plates were incubated for 1 h with monoclonal anti-nucleocapsid virus mouse antibody (Genscript) diluted 1:1000 in blocking buffer (PBS 1X containing 1% BSA (Sigma Aldrich ...
-
bioRxiv - Pathology 2024Quote: The following primary antibodies were used for western blot: TSP2 Antibody (1:250, GenScript), β-Catenin Antibody (1:500 ...
-
bioRxiv - Biochemistry 2024Quote: ... and eluted by W1 buffer supplemented with 250 μg ml-1 Flag peptide (Genscript). The eluent was concentrated and further purified by size-exclusion chromatography (Superose-6 Increase 10/300 column ...
-
bioRxiv - Biochemistry 2024Quote: ... anti-MBP tag Mouse Monoclonal antibody was used at 1:1000 dilution (GenScript, A00190), GST tag Mouse Monoclonal antibody was used at 1:1000 dilution (STARTER ...
-
bioRxiv - Biochemistry 2020Quote: ... Proteins were separated in 4-20% gradient precast PAGE gels (Genscript) and stained by Coomassie blue.
-
bioRxiv - Microbiology 2022Quote: ... Protein samples were separated by 4– 12% gradient SDS-PAGE (GenScript) and blotted onto nitrocellulose or PVDF membranes ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and loaded onto a 4 – 12% gradient SDS-PAGE gel (Genscript) for electrophoresis ...
-
bioRxiv - Systems Biology 2020Quote: ... resolved on a 4-20% gradient ExpressPlus™ PAGE gels (GenScript) and transferred to PVDF membranes (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were loaded on 4–20% polyacrylamide gradient gels (#M42015, GenScript), according to the guidelines of the manufacturer ...
-
bioRxiv - Neuroscience 2023Quote: ... and on 4-20% polyacrylamide gels (GenScript® Express Plus PAGE) in Tris-MOPS-SDS running buffer (GenScript® Running Buffer Powder ...
-
bioRxiv - Cell Biology 2024Quote: ... were separated via SDS-PAGE using 4-12% Bis-Tris (Genscript) in 1X MES Running Buffer (Genscript ...
-
bioRxiv - Cell Biology 2024Quote: ... Proteins were separated on 4-12% gradient precast SurePAGE gels (GenScript), and subsequently transferred to nitrocellulose membranes (Amersham Bioscience ...
-
bioRxiv - Bioengineering 2024Quote: ... proteins were separated on 4–12% SurePAGE gradient gel (M00725, GenScript), transferred to Immobilon-P PVDF membrane (IPVH00010 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The samples were separated by 4-20% SurePAGE™ Gel (GenScript) for 1 h at 140V and then transferred to PVDF membranes for 2 h at 75V ...
-
bioRxiv - Molecular Biology 2020Quote: HCoV-19 S gene (virus isolate: Wuhan Hu-1; GenBank number QHD43416.1) was synthesized (Genscript) with codons optimized for insect cell expression ...