Labshake search
Citations for GenScript :
551 - 600 of 1324 citations for Mouse Anti HIV 1 p24 Recombinant Antibody clone 183 H12 5C since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: Human RET-GFP and RET712-1114-GFP were cloned by PCR using a cDNA clone (GenScript Biotech; NM_020975.6) as template ...
-
bioRxiv - Genetics 2023Quote: ... Identified homozygous PC-9_ EGFRdel19-ARTi clones were further engineered by cutting endogenous EGFR with a CRISPR all-in-one vector pX458_Exon20_gRNA TAGTCCAGGAGGCAGCCGAA (GenScript) using X-tremeGENE 9 DNA transfection reagent (Roche ...
-
bioRxiv - Neuroscience 2024Quote: ... Genes that proved more problematic to clone were codon optimized and synthesized into a pcDNA3.1(+) vector by Genscript synthesis services ...
-
bioRxiv - Plant Biology 2024Quote: ... Squash leaf curl China virus Rep (KC222956.1) and the TYLCV infectious clone (based on AJ489258.1) were synthetized by GenScript. Clones for the coding sequences of AtSCE1 (At3g57870 ...
-
bioRxiv - Microbiology 2024Quote: ... The following gRNA sequence targeting ATF3 was cloned into pLentiCRISPRv2 plasmid: 5’-CCACCGGATGTCCTCTGCGC-3’ (Genscript, Clone ID C88007). HEK 293FT cells were co-transfected with pLentiCRISPRv2-ATF3 CRISPR gRNA ...
-
bioRxiv - Neuroscience 2024Quote: ... The mouse Tmem63b gene (NM_198167) was synthesized by GenScript.
-
bioRxiv - Cancer Biology 2022Quote: The open reading frame of mouse GPx2 (GenScript NM_030677.2) was subcloned by PCR into Xho1/BamH1 restriction sites of lentiviral expression vector pLVX-puro (Clontech) ...
-
bioRxiv - Cell Biology 2023Quote: ... A rabbit polyclonal antibody (Genscript) produced against full-length Drosophila p23 (Q9VH95 ...
-
bioRxiv - Cell Biology 2024Quote: Antibodies were produced by GenScript USA (Piscataway ...
-
bioRxiv - Cell Biology 2024Quote: Antibodies were produced by GenScript USA (Piscataway ...
-
bioRxiv - Microbiology 2022Quote: ... antibodies for α-Cis1a (GenScript) and α-Cis2 (GenScript ...
-
bioRxiv - Microbiology 2024Quote: Antibodies were produced by Genscript as human IgG1 kappa isotypes ...
-
bioRxiv - Biochemistry 2024Quote: ... Antibodies were procured from GenScript with human Fc domains and stored in 1X TBS pH 7.4 ...
-
bioRxiv - Developmental Biology 2022Quote: ... the samples were incubated for 1 hr at RT with horseradish peroxidase-conjugated anti-rabbit IgG (GenScript, A00098) or anti-mouse IgG (Pronteintech ...
-
bioRxiv - Developmental Biology 2021Quote: ... The fusion protein MBP-Hyx 1-176 was purified and injected into guinea pigs and the antibodies generated were purified by GenScript (Hong Kong).
-
bioRxiv - Immunology 2023Quote: Neutralizing antibodies were assessed using the cPass SARS-CoV-2 Neutralization Antibody Detection Kit (GenScript) according to manufacturer’s instructions with the following changes ...
-
bioRxiv - Microbiology 2020Quote: ... hnRNPUL1 (NM_007040) and PEG10 (NM_015068.3) were PCR amplified from ORF clones (hnRNPL, GenScript #OHu14072; hnRNPUL1, Origene #RC200576; PEG10, GenScript #OHu101111) and the products were cloned into the mammalian expression plasmid pCAGGS ...
-
bioRxiv - Immunology 2021Quote: ... The full-length native chicken ovalbumin (OVA) gene inserted in a pcDNA3.1+ plasmid (clone ID: OGa28271) was purchased from GenScript. Gene inserts from pcDNA3.1+ plasmids were cloned into the pAM2AA backbone incorporating the liver-specific human α-1 antitrypsin promoter and human ApoE enhancer flanked by AAV2 inverted terminal repeats ...
-
bioRxiv - Genetics 2024Quote: ... Rbbp5 (NM_140952.3) wild-type and variant (p.T231I and p.E295D) lines were obtained (clone OFa19095D, GenScript USA, Inc., NJ, USA). Constructs were transformed using high efficiency E ...
-
bioRxiv - Microbiology 2022Quote: ... were commercially synthesized and cloned into the multiple clone sites of NdeI/XhoI in vector pET-29a(+) (GenScript, USA), and then were transformed into E ...
-
bioRxiv - Biochemistry 2020Quote: Western blot analyses of protein samples were performed as described previously for rabbit anti-Tse1 (diluted 1:5,000; Genscript), rabbit anti-FLAG (diluted 1:5,000 ...
-
bioRxiv - Plant Biology 2023Quote: ... the supernatant was isolated by centrifugation at 80,000 × g for 1 h and incubated with Anti-DYKDDDDK G1 Affinity Resin (GenScript) at 4 °C for 30 min ...
-
bioRxiv - Plant Biology 2022Quote: ... The immunoprecipitated proteins were separated by SDS-PAGE electrophoresis and detected by anti-GST (A00865-200, 1:5,000, Genscript) and anti-MBP (E8032 ...
-
bioRxiv - Immunology 2023Quote: ... plus 10 ng/mL of mouse IL-2 (Z02764, Genscript) in 2 mL complete RPMI1640 medium for 72 h.
-
bioRxiv - Microbiology 2023Quote: ... The membranes were then incubated overnight at 4 °C in PBST with polyclonal rabbit antibodies raised against mcrA (1:10000 dilution) (GenScript, Piscataway, NJ, USA), washed four times for five minutes in PBST ...
-
bioRxiv - Molecular Biology 2020Quote: ... Flag antibody was purchased from GenScript. PPP2CA (I3482-I-AP) ...
-
bioRxiv - Microbiology 2022Quote: Antibody genes were synthesized by Genscript and recombinantly produced in a human IgG backbone ...
-
bioRxiv - Microbiology 2021Quote: ... Purified antibody was produced by Genscript as human IgG in HD 293F mammalian cells ...
-
bioRxiv - Microbiology 2021Quote: ... or CaTpk2 rabbit polyclonal antibody (GenScript), at 1:1,000 dilution in 5% nonfat dry milk in TBS-T buffer plus 0.5% sodium azide for 2 hours at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... This antibody was generated by GenScript, and is derived from the same peptide sequence used to elicit “3148” from the Nelson’s lab (46) ...
-
bioRxiv - Immunology 2023Quote: ... THETM DYKDDDDK tag antibody (A00188; Genscript) and Direct-BlotTM HRP anti-mCherry antibody (clone 8C5.5 ...
-
bioRxiv - Microbiology 2022Quote: ... while the TAP antibody (Genscript, Inc) and the HA monoclonal antibody 2-2.2.14 (Invitrogen ...
-
bioRxiv - Neuroscience 2024Quote: Monoclonal antibodies were generated by GenScript Inc ...
-
bioRxiv - Cancer Biology 2024Quote: ... The murine 2G12-2B2 antibody (Genscript) was used at 3 ug/ml ...
-
bioRxiv - Developmental Biology 2021Quote: ... The ORF was subcloned into the BamH1 site of pCS2+ (pCS2+-sobp) using the Clone EZ PCR cloning kit (GenScript). pCS2+-5’HA-sobp and pCS2+-sobp-3’HA were generated using the QuikChange lightning Site-directed mutagenesis kit (Agilent) ...
-
bioRxiv - Biochemistry 2020Quote: ... two stable sub-clonal cell lines of each parental clone were chosen for cryopreservation based on the result of ELISA (GenScript). Positive cell supernatants were evaluated by WB against 200 ng of purified protein/lane using a 1:10 dilution in-house as described ...
-
bioRxiv - Immunology 2022Quote: ... RNA-sequencing was applied to confirm the full-length JURV genome (10,993 bp) as previously described.4 Infectious JURV was recovered from a full-length cDNA clone (Genscript, USA) comprising genes encoding for the nucleoprotein (JURV-N) ...
-
bioRxiv - Biochemistry 2023Quote: ... wild-type APE1 was expressed in the absence of any tags from a pet28a codon optimized clone purchased from GenScript. The plasmid was transformed into One Shot BL21(DE3)plysS E ...
-
bioRxiv - Biochemistry 2023Quote: Human full-length wild-type DNA Pol β was overexpressed from a PET-28a codon optimized clone purchased from GenScript in the BL21-CodonPlus(DE3)-RP E ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Nb protein sequences acquired from literature (previously named 22A3 and 23A3)35 were codon optimized for bacterial expression and cloned into a pET26b expression in frame with pelB and His6 sequences using clone EZ service from GenScript. The production and purification of Nb6E (previously named VHH05 ...
-
bioRxiv - Biochemistry 2024Quote: Cloning of hPINK1 constructs for insect cell expression and test purifications The coding sequences for the PINK1 constructs were PCR amplified using clone OHu25380D (Genscript) as a template and cloned into the vector pFB-6HZB (SGC ...
-
bioRxiv - Biochemistry 2023Quote: ... was generated by PCR using primers 1941 and 1942 and as a template the clone in PD912-GAP which was obtained from Genscript, Piscataway ...
-
bioRxiv - Cell Biology 2023Quote: PLIN1 and APEX2-V5 fragments were amplified by PCR from PLIN1 cDNA ORF clone in pcDNA3.1+/C-(K)-DYK vector (GenScript: OHu22113) and Twinkle-APEX2-V5 vector (Addgene ...
-
bioRxiv - Genetics 2024Quote: UAS-human ECHS1 transgenic flies (hECHS1) were generated by gene synthesis of human ECHS1 cDNA (LD24265, #7061) Clone ID OHu09094C from Accession NM_004092 (Genscript Inc). Human ECHS1 has a single transcript ...
-
bioRxiv - Cell Biology 2024Quote: The cDNA of human PIP4P2 was prepared by PCR using the commercial TMEM55A ORF clone in a pcDNA 3.1 (Genscript; SC1200) as a template ...
-
bioRxiv - Immunology 2021Quote: ... for >1 hour at ambient temperature then incubated with *** μg / protein gel of MonoRab anti-his tag C-term (Genscript) in Intercept T20 (PBS ...
-
bioRxiv - Immunology 2022Quote: ... binding of SARS-CoV2 and control IgG antibodies (at 1 µg/ml) to 15-mer S2 overlapping 5-amino acid peptides (n=52, GenScript Biotech, 500 ng/well) was tested using the same procedure as previously described (Wardemann ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The mouse ASIC1a subunit was synthesized by GenScript (new Jersey, USA) with SacI and BamHI restriction sites flanking the start and stop codons ...
-
bioRxiv - Bioengineering 2024Quote: ... All synthesized sequences were codon-optimized for mouse expression (GenSmart, GenScript).
-
bioRxiv - Cell Biology 2024Quote: ... The human LEP mRNA sequence was sourced from the cDNA construct hLEP-pcDNA3.1(+)-C-(K)DYK (GenScript, clone ID OHu27387; NM_000230.3). Leptin-SBP-HaloTag plasmid was generated by inserting the WT LEP gene into the backbone derived from pMPx92 using restriction digest and Gibson assembly ...