Labshake search
Citations for GenScript :
551 - 600 of 606 citations for L β Homo β 2 hydroxyphenyl glycine; R 3 Amino 3 2 hydroxyphenyl propanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: ... A protease solution (9.5 ml lysis buffer with 2 mM TCEP and 500 µl His-tagged TEV protease (10KU, Genscript or in-house purified)) was then added to release DDX4N1 CtoA into the solution during over-night incubation at room temperature with gentle mixing ...
-
bioRxiv - Biochemistry 2024Quote: ... and the supernatant was loaded onto a gravity Ni-NTA column (2-5 ml Ni-charged resin FF from GenScript, Cat# L00666-25). The Ni-NTA column was washed and then the His-tag fused protein was eluted using step-gradient of imidazole (50 ...
-
bioRxiv - Biophysics 2020Quote: ... 10 nM NS2B-NS3pro was incubated with the substrate benzoyl-Nle-Lys-Arg-Arg-7-amino-4-methylcoumarin (Bz-nKRR-AMC) (Genscript) at concentrations varying from 2 to 200 µM ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: Michaelis-Menten kinetics of pre-SplB mutants were measured with the peptide substrate Ac-WELQ-AMC (Ac: acetyl-; AMC: 7-Amino-4-methylcoumarin, stock concentration: 26 mM in DMSO, concentration range: 13-1161 μM, Genscript) at an enzyme concentration of 125 nM to 2.5 μM using a Tecan infinite 200Pro (excitation wavelength 339 nm ...
-
bioRxiv - Biophysics 2023Quote: The plasmid harboring wild-type Tsa1 (pET19b-Tsa1) was originally obtained with an amino-terminal deca-histidine-tag in a codon-optimized manner from GenScript (kind gift from P.O ...
-
bioRxiv - Biochemistry 2024Quote: The peptidase activity of the 20S CP was measured using a pair of substrates: the tripeptide benzyloxycarbonyl-Val-Leu-Arg-7-amino-4-methylcoumarin (Z-VLR-AMC, Genscript) and a 11-residue oligopeptide conjugated to 7-methoxycoumarin-4-acetic acid referred to as LF211 (7-methoxycoumarin4-acetic acid (MCA)-Lys-Lys-Val-Ala-Pro-Tyr-Pro-Met-Glu-(dinitrophenyl)diaminopropionyl-NH2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were stained with biotinylated protein L (GenScript, Piscataway, NJ), goat anti-mouse IgG ...
-
bioRxiv - Microbiology 2022Quote: ... Mice from WT and CST-KO groups were injected intraperitoneally once daily with CST (2 μg/g body weight; Genscript Biotech Corporation, Piscataway, NJ) for 15 days based on previous experimentation 15 ...
-
bioRxiv - Microbiology 2020Quote: ... The cDNA for SARS-CoV-2 Spike protein ectodomain residues 1 to 1220 (S-Ectodomain-GFP) was chemically synthesized with optimal insect cell codons (Genscript USA Inc, NJ, USA) and cloned into pVL1393 (Expression Systems ...
-
bioRxiv - Immunology 2021Quote: ... One million cells per well were added to a U-bottom 96-well plate and were stimulated with 5 μg/ml of pools of overlapping SARS-CoV-2 S protein peptides (GenScript USA Inc, Piscataway, NJ). The stimulation was performed by incubation for 6 h at 37°C and 5% CO2 in the presence of Protein Transport Inhibitor Cocktail (brefeldin A ...
-
bioRxiv - Neuroscience 2023Quote: ... in the middle of exon 2 was conjugated to KLH to improve antigenicity of the peptide sequence followed by polyclonal antibody production in rabbits (Genscript, Inc. Piscataway, NJ, USA). Anti-Bdwf antibody was affinity purified against the antigenic peptide and specificity was confirmed by immunohistochemistry analyses.
-
bioRxiv - Immunology 2023Quote: ... and cloned into the CMV/R vector (Barouch et al. 2005) by Genscript with a C-terminal hexahistidine affinity tag ...
-
bioRxiv - Biophysics 2024Quote: ... CFTR R region-Cterm insert sequences were codon-optimized and ordered from GenScript. CFTR R region-Cterm gene inserts were amplified by PCR and cloned into pET plasmids using Gibson assembly ...
-
bioRxiv - Neuroscience 2024Quote: ... where the cysteine at position 29 was replaced by aspartic acid (Genscript). The synthesized constructs were injected into flies and targeted to attP1 or attP2 insertion sites on the second or third chromosomes respectively and the transgenic progeny were balanced either over CyO or TM6C (BestGene) ...
-
bioRxiv - Genetics 2020Quote: Primary anti-rabbit antibody against SYCE1 amino-terminal region (i.e. capable of detecting WT SYCE1 and its putative truncated form) was developed at GenScript (GenScript USA Inc.), using peptides ATRPQPLGMEPEGSC and CPEGARGQYGSTQKI from the amino-terminal region of the protein ...
-
bioRxiv - Microbiology 2022Quote: ... The pcDNA3-SARS-CoV-2-Spike plasmid contains a codon- optimized ORF for Spike from GenBank NC_045512 that was synthesized by GenScript (a kind gift from David Kelvin) then cloned between the KpnI and BamHI sites of pcDNA3.1(+) ...
-
bioRxiv - Pathology 2021Quote: ... Samples were mixed by vortexing and tested using the GenScript cPass™ SARS-CoV-2 Neutralization Antibody Detection Kit (GenScript USA, Inc. Piscataway, NJ, USA) according to the manufacturer’s protocol.
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was filtered and applied to protein-L resin (GenScript) equilibrated with 5 column volume (CV ...
-
bioRxiv - Genetics 2023Quote: The RNase R sequence from Mycoplasma genitalium (accession number: WP_009885662.1) was synthesized by GenScript Biotech Co ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells expressing Hu08TM were stained with biotinylated protein L (GenScript, Piscataway, NJ) and secondary detection was achieved by the addition of streptavidin-coupled PE (BD Biosciences ...
-
bioRxiv - Biochemistry 2022Quote: ... The primary antibody (rabbit anti-ScV-L-A peptide serum by GenScript) was diluted at 2:25000 in 2% (w/v ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... were purchased from Santa Cruz Biotechnology (item sc-222407, sodium ursodeoxycholic acid, ≥98% purity) or synthesized by Genscript ((pyroE)WLGGRFamide ...
-
bioRxiv - Microbiology 2020Quote: ... with all lysine residues predicted facing the cytoplasm mutated (TbAQP25K>R) was designed and synthesized by GenScript and verified by sequencing ...
-
bioRxiv - Biochemistry 2024Quote: ... PDZbm cargo peptide 5-HT4(a)R-pS-5 (Phosphorylated at Serine -5 position; commercially synthesized from Genscript) was dissolved in 20 mM Hepes (pH 7.5) ...
-
bioRxiv - Microbiology 2020Quote: ... The expression of each anti-HIV-1 CAR was detected by protein L-biotin (GenScript) and Alexa488-conjugated anti-human Fc antibody or APC-conjugated anti-human Fc antibody as described elsewhere [78] ...
-
bioRxiv - Cancer Biology 2024Quote: ... The expression of the CAR was detected using a biotinylated protein L (GenScript, Piscataway, NJ) antibody and streptavidin-coupled PE (BD Biosciences ...
-
bioRxiv - Microbiology 2024Quote: ... four fragments with 21-25 nucleotide overlaps encoding the JCV L segment were synthesized (GenScript). pJCV-L_linker was amplified using 2x Q5 high-fidelity master mix ...
-
bioRxiv - Bioengineering 2020Quote: ... in the presence of varying amounts of argininylglycylaspartic acid (RGD, CGRGDS, 2.0 mM, Genscript, George Town, KY), heparin-binding peptide (HBP ...
-
bioRxiv - Molecular Biology 2021Quote: A construct containing the lysine (K) to arginine (R) mutations within Apl5 PASK cluster was created custom by GenScript and used for the experiments listed in Supplemental Fig 1 and Supplemental Fig 2 ...
-
bioRxiv - Neuroscience 2023Quote: ... An IgG2b expression plasmid encoding the K89/34 IgG2b R-mAb was generated to order by Genscript (https://www.genscript.com/) by replacing the mouse IgG2a (ψ2a ...
-
bioRxiv - Immunology 2020Quote: ... Genes for expression of HA fusions to nanoparticle trimeric components were codon optimized for expression in human cells and cloned into the CMV/R (VRC 8400) mammalian expression vector by Genscript. All HA fusions to the I53_dn5B trimer contained full-length HA ectodomains including native secretion signals ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This gene was codon optimized for human cell expression and made in the CMV/R mammalian expression vector by Genscript. Transient transfection into HEK293F cells was carried out using PEI MAX ...
-
bioRxiv - Neuroscience 2023Quote: ... SnifferOT cells were transiently transfected to express the red fluorescent genetically encoded calcium indicator R-GECO (GenScript, Piscataway, NJ, USA) with Fugene HD reagent (Promega ...
-
bioRxiv - Immunology 2023Quote: ... and were codon-optimized for human cell expression and made in the CMV/R vector (Barouch et al. 2005) by Genscript with a C-terminal hexahistidine affinity tag ...
-
bioRxiv - Cell Biology 2023Quote: ... and the primers covering SNPs in the Cth (F- GAGCCTGGGAGGATATGAGA, R- AAGCTCGATCCAGGTCTTCA) and Ttc4 (F – GACAGGGCGGAACTATACCA, genes. qPCR products were Sanger sequenced using the GenScript Biotec Sanger sequencing service.
-
bioRxiv - Immunology 2024Quote: ... The sequences were codon-optimized for human cell expression and cloned into pCMV/R using the XbaI and AvrII restriction sites by Genscript. The plasmids for hACE2-Fc ...
-
bioRxiv - Microbiology 2022Quote: ... SDS-PAGE was performed using 30 μ l of sample with 4-20% Bis-Tris gels (Genscript) in Tris-MOPS-SDS running buffer (Genscript) ...
-
bioRxiv - Biochemistry 2024Quote: ... Clarified lysate from 1 L of culture was incubated with 1 mL of equilibrated Ni-resin (Genscript) and washed with 30 mL wash buffer (50 mM Tris pH 7.5 ...
-
bioRxiv - Biophysics 2020Quote: ... or a SARS-CoV (amino acid residues 1 to 1193) (GenBank: AAS00003.1) were synthesized using -optimized codons for Cricetulus griseus (CHO Cell) by GenScript. The cDNAs were subcloned into pTRIMER expression vector (GenHunter ...
-
bioRxiv - Immunology 2020Quote: ... protein (amino acid residues 1 to 1211) (GenBank: MN908947.3) was gene-synthesized using Cricetulus griseus (Chinese hamster)-preferred codons by GenScript. The cDNA was subcloned into pTRIMER expression vector (GenHunter Corporation ...
-
bioRxiv - Cell Biology 2024Quote: FITC-labeled aminocaproic acid-disulfide-cyclized ACRGDGWCG peptide (FITC-cyclic-ACRGDGWCG) and FITC-labeled aminocaproic acid-GRGDLGRLKK peptide (FITC-proTGFβ3 peptide) were synthesized by GenScript. Preliminary experiments (Supplementary Fig ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The sialic acid synthase protein (NCBI accession # XP_021429200) was commercially produced using the insect expression vector pFastBac1 (GenScript U488UFB180).
-
bioRxiv - Biochemistry 2021Quote: Synthetic Crotamine derivative peptides (CDP) in the L- and D-enantiomeric conformations were synthesised by Genscript (Leiden, NL), with a purity of > 95% (Supplementary Fig ...
-
bioRxiv - Biochemistry 2021Quote: Custom antibodies were generated in rabbits against the peptide CEHRKRFDEERLRFL corresponding to amino acids 297-310 of PfKelch13 sequence (the cysteine at the N-terminus was added for conjugation to KLH) by Genscript Inc ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... A custom-made antibody directed against peptide CKVGEPRGVSPEDMG of the sialic acid synthase (NCBI accession # XP_021429200) was purchased (GenScript U881EER070) and used at a dilution of 1/2000 ...
-
bioRxiv - Plant Biology 2022Quote: ... the MMV L gene from 2893 nucleotides-ST-LS1-pJL89 terminator in pUC57 was synthesized de novo by GenScript. To generate pJL-L-intron ...
-
bioRxiv - Microbiology 2024Quote: Natural IgM and IgG were purified from normal murine serum using Protein G and Protein L resin (GenScript, China) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... CAR T cells were evaluated for CAR expression on the surface by flow cytometry with protein L (1:100; M00097, Genscript) as previously described(47) ...
-
bioRxiv - Cell Biology 2020Quote: ... S100 supernatant was added directly to 600 μL of basic lysis buffer with protease inhibitors and NEM containing 30 μL 1:1 anti FLAG Affinity Gel (Genscript). All samples were incubated overnight at 4°C ...
-
bioRxiv - Immunology 2022Quote: ... Bound IgG was detected as the luminescence signal at 425 nm using an HRP-conjugated anti-human IgG (H&L) secondary antibody (Genscript) and SuperSignal ELISA Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific).