Labshake search
Citations for GenScript :
551 - 600 of 625 citations for 1 Bromo 3 difluoromethoxy benzene since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... AA 1-154) of Aquifex aeolicus were fused by a Gly-Ser linker and constructed in a pUC57 plasmid by GenScript USA ...
-
bioRxiv - Molecular Biology 2024Quote: ... was identified by transferring the gel contents onto a 0.2 μm nitrocellulose membrane and probing it with a primary antibody (1:1000) targeting the C-terminal region of the wild-type TTR sequence from GenScript. A secondary antibody ...
-
bioRxiv - Cancer Biology 2024Quote: ... miR-19a and the NTC sequences were encoded into the pre-miR-30-based short hairpin cassette flanked with MLU-1 restriction (GenScript). Both miRNA-encoding plasmids and MG1 shuttle plasmids were digested using MLU-1 (NEB ...
-
bioRxiv - Biochemistry 2024Quote: ... Human CI-MPR cDNA (amino acids 1-2304) with C-tail HPC4 tag (EDQVDPRLIDGK) codon optimized for CHO expression was ordered from Genscript in pcDNA3.1 plasmid ...
-
bioRxiv - Biophysics 2024Quote: ... and deletion of residues 1-20 (mj-120, with Met1 at position 20) were encoded into the pET21a(+) vector (Genscript). Protein expression constructs used in this study did not include solubility or purification tags ...
-
bioRxiv - Cell Biology 2024Quote: ... the cytosol-exposed domain of CCPG1 (1-212aa) fused to a C-terminal GST-tag was gene synthesized by Genscript and cloned into a pET-DUET1 vector ...
-
bioRxiv - Cell Biology 2024Quote: ... the cytosol-exposed domain of FKBP8 (1-391aa) fused to a C-terminal GST-tag was gene synthesized by Genscript and cloned into a pET-DUET1 vector ...
-
bioRxiv - Cell Biology 2024Quote: ... was established from screening hybridomas generated from mice immunized with purified N-terminus of mouse CATSPER1 (1-150 aa; GenScript) followed by Protein G affinity purification.
-
bioRxiv - Biochemistry 2024Quote: Genes encoding Ndas1146 (Uniprot: D7B1W6) and Ndas1147 (Uniprot: D7B1W7) from Nocardiopsis dassonvillei were cloned into a pRSFDuet-1 vector by Genscript. Before further use ...
-
bioRxiv - Cell Biology 2024Quote: The Golgin84-HA-OMP DNA construct contains human GOLGA5 (residues 1-698) fused with HA epitope and C-terminal transmembrane domain of OMP25 (aa 110-145) was synthesized by GenScript and subcloned into pcDNA3.1 ...
-
bioRxiv - Microbiology 2020Quote: ... the recombinant protein of the extracellular domain of human ACE2 (aa 1-740) fused to Fc (ACE2-Fc, Genscript, Nanjing, China) was coated on 96-well microtiter plate (50 ng/well ...
-
bioRxiv - Biophysics 2021Quote: ... at C-terminal was cloned into pGEX-6P-1 vector at BamHI and XhoI sites using gene synthesis and cloning services (GenScript, USA). The plasmid was transformed into E ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... rosetta synaptobrevin a codon-optimised nucleotide sequence encoding the soluble portion of the protein [Syb (1-75)] was prepared by gene synthesis (Genscript, USA): GAGGCGAACCGTACCGGTGACTACCGTCTGCAGGAAGCGCAGCGTCAAGTGGGCGAAGTT CAAAACGTGATGCGTGATAACCTGACCAAGGTTATCGAGCGTGGTGAAAAACTGGACGATC TGGACGCGAAGGCGGAAGATCTGGAGGCGGAGGGTCAGCGTTTCCAAAACCGTGCGGGCC GTCTGCGTCGTCAGATGTGGTGGCAAAACAAACGTAACCAGTAA
-
bioRxiv - Cell Biology 2020Quote: ... consensus sequence was obtained from RepeatMasker and/or from repbase (http://www.repeatmasker.org/) synthetized and cloned into pUC57 by GenScript (Supplementary Table 1). To make the IAPEz reporter (pTCH1) ...
-
bioRxiv - Microbiology 2020Quote: ... were coated overnight at 4°C with 2μg/ml of recombinant SARS-CoV-2 S1-RBD protein (GenScript No. Z03483-1) in carbonate-bicarbonate buffer (Sigma Aldrich No ...
-
bioRxiv - Cell Biology 2021Quote: ... were transfected with individual shRNA in pLKO.1 (Broad Institute, Cambridge, MA) mixed with packaging plasmid pCMV-dR8.91 (G193486, GenScript, Piscataway, NJ) and envelope plasmid pVSV-G (G178153 ...
-
bioRxiv - Immunology 2021Quote: ... and beta (1-244) chains were synthesized and cloned into the bacterial expression vector pET30a via NdeI and XhoI (Genscript, USA). Proteins were expressed as inclusion bodies in BL21 (DE3 ...
-
bioRxiv - Cell Biology 2020Quote: ... and for generation of EGFP-C2-Arp3B plasmid, the mRNA transcript variant 1 encoding murine actin-related protein 3B (Actr3b) (Jay et al., 2000) was synthesized (GenScript Biotech) and cloned into pEGFP-C2 vector (Clontech).
-
bioRxiv - Immunology 2021Quote: ... The wells were washed six times with PBS-T and incubated with 100 µL (1:10000) of Goat Anti Mouse IgG (Genscript, USA) or Anti Hamster IgG (Abcam ...
-
bioRxiv - Plant Biology 2020Quote: ... 1.5 μg of MEA or 1.5 μg of CLF (PRC2) complexes were incubated with 1 μg of Histone H3 peptides (GenScript, Piscataway, NJ) and 1.5 μCi of 3H-SAM (Perkin Elmer ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lamin-C was overproduced and purified from codon-optimized Lamin-C (amino acid residues 1-152) engineered into pRSF-Duet plasmid (Genscript Inc.). The construct carries a tandem N-terminal Strep-tag ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Mammalian plasmid pcDNA3.1(+)-pHluorin was made by synthesizing and cloning a codon optimized sequence of pHluorin into the pcDNA3.1(+) backbone (GenScript; Piscataway, NJ).
-
Development of monoclonal antibody-based blocking ELISA for detecting SARS-CoV-2 exposure in animalsbioRxiv - Microbiology 2023Quote: ... The SARS-CoV-2 full-length N gene of Wuhan-hu-1 isolate (GenBank # NC 045512.2) was synthesized (GenScript, Piscataway, NJ) and cloned in the pET-28a (+ ...
-
bioRxiv - Immunology 2023Quote: DNA encoding for residues 24-167 of the extracellular portion of human PD-1 (UniProt Q15116) with a C-terminus histidine tag or corresponding PD-1 N58Q mutant were cloned into pcDNA3.4 by GenScript (Piscataway, NJ). Expi293 cells were transiently transfected with plasmid DNA mixed with PEI (Polysciences ...
-
bioRxiv - Neuroscience 2022Quote: We generated the UAS-syt1GCaMP6F construct by cloning the cDNA sequence of Drosophila synaptotagmin 1, a 3x GS linker, and the GCaMP6F sequence into the pJFRC7-20XUAS vector (Pfeiffer et al., 2010) (Genscript Biotech). The GS linker connects the C-terminus of syt1 to the N-terminus of GCaMP6F (after Cohn et al. ...
-
bioRxiv - Microbiology 2023Quote: ... The solution was replaced with blocking buffer with appropriate dilutions of primary antibody (1:500 Rabbit anti-ChmC (Genscript, custom-generated) or 1:2,000 Rabbit anti-OmpA ...
-
bioRxiv - Biochemistry 2022Quote: ... The gene sequences for the PDZ domain of human PDLIM7 (1-84) and various point mutants were synthesised as codon optimised constructs and cloned into pET30b(+) by Genscript (USA) for bacterial expression with an N-terminal 6His-tag.
-
bioRxiv - Cancer Biology 2022Quote: ... SdAb detection was performed using (1:20000) MonoRab™ Rabbit Anti-Camelid VHH Antibody conjugated to HRP (GenScript, Cat. # A01861-200) in MTBST 0.05% ...
-
bioRxiv - Microbiology 2022Quote: ... the chromatography column was resuspended with 1 ml TCB as well as 20 μl (200 U) of TE protease enzyme (Genscript, Inc) on a rotator and the columns incubated at 4°C for 16 hours ...
-
bioRxiv - Synthetic Biology 2024Quote: DROP-CAR expression in B3Z cells was evaluated via labeling with a 1:200 dilution of biotinylated anti-Strep tag antibody (GenScript, A01737) binding the TMD-containing chain of the DROP-CAR ...
-
bioRxiv - Microbiology 2024Quote: ... the membranes were incubated with an anti-Strep tag II antibody (THE™ NWSHPQFEK Tag Antibody, GenScript, USA, 1:1000 dilution) to detect Strep-tagged nsp1 and with an anti-GAPDH mouse-antibody (1:1000 dilution ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit polyclonal anti-AQP4ex generated against the peptide DSTEGRRDSLDLASC within the AQP4 C-terminus (1:1000; GenScript Biotech, Piscataway, NJ, USA), mouse monoclonal anti- OMP (1:300 ...
-
bioRxiv - Biophysics 2024Quote: ... a pGEX-4T-1 vector coding for SH downstream of a GST carrier protein and a thrombin cleavage site was acquired from GenScript (US). The plasmid was transformed into competent E ...
-
bioRxiv - Cell Biology 2024Quote: ... we purchased the gene-synthesized codon-optimized cytosol-exposed domain of BNIP3 (1-158aa) fused to a C-terminal GST-tag in a pFastBac-Dual vector from Genscript (RRID:Addgene_223764). Point mutants were introduced by in vitro mutagenesis to generate BNIP3 E44A/L47A/D49A/A50K/Q51A (5A ...
-
bioRxiv - Biochemistry 2024Quote: ... EYA3 and EYA3H79R were expressed with a C-terminal StrepII tag for detection using a Strep antibody (Genscript, A01732, 1:1000).
-
bioRxiv - Developmental Biology 2021Quote: ... The fusion protein MBP-Hyx 1-176 was purified and injected into guinea pigs and the antibodies generated were purified by GenScript (Hong Kong).
-
bioRxiv - Biochemistry 2020Quote: A human Kif15 motor domain and neck linker construct (Kif15_MD residues 1-375) in a pET21a vector with a C-terminal 6 x His-tag was generated by chemical synthesis (GenScript, Piscataway, NJ). Six of the eight cysteine residues (C5S ...
-
bioRxiv - Biochemistry 2020Quote: ... of SARS-CoV-2 and the ectodomain of human angiotensin converting enzyme 2 (ACE2; residue 1-615) were synthesized by GenScript (Piscataway, NJ). The S gene was fused with a C-terminal twin Strep tag [(GGGGS)2WSHPQFEK(GGGGS)2WSHPQFEK)] and cloned into a mammalian cell expression vector pCMV-IRES-puro (Codex BioSolutions ...
-
bioRxiv - Biochemistry 2020Quote: ... of SARS-CoV-2 (D614) and the ectodomain of human angiotensin converting enzyme 2 (ACE2; residue 1-615) were synthesized by GenScript (Piscataway, NJ). The S gene was fused with a C-terminal twin Strep tag [(GGGGS)2WSHPQFEK(GGGGS)2WSHPQFEK)] and cloned into a mammalian cell expression vector pCMV-IRES-puro (Codex BioSolutions ...
-
bioRxiv - Biophysics 2021Quote: ... Human l-Opa1 (isoform 1) and s-Opa1 with Twin-strep-tag at N-terminus and deca-histindine tag at C-terminus (GenScript, NJ, USA) was expressed in Pichia pastoris strain SMD1163 ...
-
bioRxiv - Biochemistry 2022Quote: ... The lysate was run on separate 12% SDS–polyacrylamide gel and probed using βarr antibody and HRP-coupled protein L antibody (dilution-1:2,000; GenScript; cat. No. M00098) by western blotting ...
-
bioRxiv - Molecular Biology 2020Quote: ... HRAS and NRAS gene sequences (residues 1–166, with an N-terminal His-tag and C-terminal BAP-tag were synthesized by GenScript (Piscataway, USA) and cloned into pET11a ...
-
bioRxiv - Microbiology 2020Quote: A synthetic gene encoding an human ACE2 fragment (residues 1-615) fused with a C-terminal 6xHis tag was generated by GenScript (Piscataway, NJ) and cloned into pCMV-IRES-puro expression vector (Codex BioSolutions ...
-
bioRxiv - Microbiology 2021Quote: ... of the SARS CoV2 isolate Wuhan-hu-1 genome (Genbank: NC_045512) were commercially synthesized and cloned into pUC57 vector (Genscript, New Jersey, USA). RNA motif plasmid cloning backbone [(pRMB ...
-
bioRxiv - Microbiology 2022Quote: ... Fifteen-mer overlapping peptides from SARS-CoV-2 spike glycoprotein (Cat# PM-WCPV-S-1, JPT peptides, Berlin, Germany) and MeV-nucleoprotein (Genscript, NJ, USA) were used to stimulate splenocytes at 5 µg/mL ...
-
bioRxiv - Microbiology 2023Quote: ... A synthetic standard containing base positions 1-200 from the 16S rRNA gene sequence was used for the standard curve (GenScript, Rijswijk, Netherlands). The qPCR was carried out on a Strategene Mx3005P qPCR machine (Agilent Technologies ...
-
bioRxiv - Developmental Biology 2024Quote: ... the membranes were incubated overnight at 4°C with anti-zebrafish Ybx1 primary antibody we prepared previously (1:2000) (GenScript, Nanjing, China) (26) ...
-
bioRxiv - Microbiology 2023Quote: ... 1 × 106 splenocytes were plated into each well of a 96-well flat-bottom plate and either left untreated or treated with 1 ug/ml p56 (AGPHNDMEI) or p79 (TSINFVKI) peptides (Genscript, Piscataway, NJ) for 5 h at 37°C in the presence of Brefeldin A (BD Cytofix/Cytoperm ...
-
bioRxiv - Biochemistry 2022Quote: ... or by adding 200 ng/well of monovalent or bivalent cAbCMY-2 (254) recognized by 1/2000 diluted rabbit anti-HCAbs antibody conjugated to HRP (Genscript, United States). TMB was used as substrate while reaction was stopped by 1 M H3PO4 ...
-
bioRxiv - Molecular Biology 2023Quote: ... A custom RHINO polyclonal antibody was outsourced from GenScript using the recombinant protein described in the “Protein purification section” with 6xHIS tag retained and produced in rabbit (GenScript; 1:1000 dilution). The secondary antibodies were mouse IgG HRP-linked (NA931 ...