Labshake search
Citations for GenScript :
501 - 550 of 792 citations for Insulin like growth factor binding protein 6 IGFBP 6 Mouse HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... gene segment containing spike protein of SARS-CoV-2 wa s synthesized by GenScript Inc ...
-
bioRxiv - Immunology 2020Quote: ... ELISA plates were coated with 200 ng/well CoV2 RBD protein (GenScript; Cat: Z03483) overnight at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... GiGrx5 and GiBolA proteins were detected by a rabbit anti-BAP polyclonal antibody (GenScript). Mitosomal GiTom40 and GiIscU were detected with a specific polyclonal antibody raised in rabbits (84) ...
-
bioRxiv - Microbiology 2022Quote: ... fumigatus-optimized fluorescent protein mNeonGreen by using vector pSR25 (synthesized by GenScript, Piscataway, NJ). Primer pairs AtrR-CoNG MH F (CCCGGTCTTCGACACCA ATGGTCCACCCCACGGTGGATTGGCTGGTGCCGGTGCTGGT ...
-
bioRxiv - Biophysics 2022Quote: ... The fusion protein MBP-Q44-HttEx1 was subcloned into a pMalc2x plasmid by Genscript. The protein expression was done in Escherichia coli BL21(DE3 ...
-
bioRxiv - Microbiology 2023Quote: Full-length wMel WalE1 and wAna FtsZ protein-encoding constructs were synthesized by GenScript using codons optimized for E ...
-
bioRxiv - Cell Biology 2023Quote: ... DCP-Bio1-bound proteins were pulled down with Streptavidin-coated magnetic beads (Genscript #L00936) overnight at 4 °C following manufacturer’s protocol ...
-
bioRxiv - Genetics 2023Quote: ... MgR protein was purified by passing through a column Nickle resin (GenScript Biotech Co.) and washed by using 3 column volumes of wash buffer (50 mM Tris-HCl at pH 8.0 ...
-
bioRxiv - Microbiology 2023Quote: The full recombinant MPL36 protein (rMPL36/aa 41-321) was commercially produced by GenScript® Biotech with His-tag in an E ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein samples were electroporated on 4-20% gradient SurePAGE™ Bis-Tris gel (Genscript) or 4-20% Tris-glycine gel (BioRad ...
-
bioRxiv - Immunology 2023Quote: ... supernatants containing the monoclonal antibodies were purified using protein A magnetic beads (Genscript, L00695). The purified samples were determined by SDS-PAGE.
-
bioRxiv - Biochemistry 2024Quote: ... Digested product was bound to 500 µL of protein A resin beads (GenScript #L00210) overnight at 4℃ on a rotating shaker ...
-
bioRxiv - Microbiology 2024Quote: ... and synthetic fragments and genes encoding the fluorescent proteins from Genscript (Supplementary Table 2).
-
bioRxiv - Microbiology 2021Quote: ... Western blot using a mouse anti-Histidine tag monoclonal Antibody (Genscript Cat. No. A00186) was used to confirm purity of the purified protein (Figure-1S) ...
-
bioRxiv - Biophysics 2022Quote: ... Biotin-labeled mouse monoclonal antibody against the Strep-tagII (“NWSHPQFEK”) was purchased from Genscript (GenScript Cat# A01737 ...
-
bioRxiv - Biochemistry 2020Quote: A custom-made mouse monoclonal antibody against the isoDGR motif was prepared by GenScript Corporation (Piscataway ...
-
bioRxiv - Cell Biology 2020Quote: To generate pLenti-mTomm70A-EGFP the open reading frame of mouse Tomm70A (GenScript OMu13526) was amplified via PCR and inserted into pcDNA-EGFP introducing a ten amino acid long linker between mTomm70A and EGFP (GGSGDPPVAT) ...
-
bioRxiv - Cell Biology 2020Quote: ... To generate pLenti-mTimm50-mRFP the open reading frame of mouse Timm50 (GenScript OMu13400) was amplified via PCR and inserted into pcDNA-mRFP introducing a ten amino acid long linker between mTimm50 and mRFP (GGSGDPPVAT) ...
-
bioRxiv - Biochemistry 2022Quote: ... The sequence encoding mouse alpha-DG N terminal domain(a-DGN) was synthesized (Genscript) and cloned into the AAV backbone under the transcriptional control of the ubiquitous CMV promoter ...
-
bioRxiv - Immunology 2024Quote: ... and incubated with FITC conjugated anti-FLAG mouse monoclonal antibody (GenScript, Cat. No. A01632) at a concentration of 2 µg per million cells for 1 hr at 37 C in the dark ...
-
bioRxiv - Biophysics 2020Quote: The cDNA sequences for the protein variants used in the study were purchased from GenScript and the proteins were N-terminally tagged with a 6xHis-Lipo domain ...
-
bioRxiv - Immunology 2021Quote: ... GST-tagged NSUN2 proteins were purified by affinity chromatography using reduced glutathione resin (GenScript, L00206) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... The sonicated DNA-Protein complexes were immunoprecipitated with the following antibodies: control IgG (A01008, GenScript), anti-TFAP2C (sc-12762 ...
-
bioRxiv - Microbiology 2019Quote: ... The blot was washed and secondary antibody (for Ryp proteins: Goat α-rabbit HRP (GenScript) 1:1,000 ...
-
bioRxiv - Biochemistry 2021Quote: Codon-optimized open reading frames for EuRe and BoMoC RT proteins were ordered from GenScript. Proteins were produced in Escherichia coli by expression from MacroLab vector 2bct with a C-terminal 6xHis tag (https://qb3.berkeley.edu/facility/qb3-macrolab/#facility-about ...
-
bioRxiv - Microbiology 2021Quote: Polyclonal Rabbit antibodies against the potential S-Layer protein of A_DKE were generated by GenScript Biotech B ...
-
bioRxiv - Neuroscience 2020Quote: ... SARS-CoV2 Spike protein (100 nM, S1 domain aa16-685, Cat# Z03485, Genscript, Piscataway, NJ), EG00229 (Cat#6986 ...
-
bioRxiv - Plant Biology 2021Quote: ... Accumulation of FHT-HA protein was assayed by immunoblot with a monoclonal HA antibody (GenScript).
-
bioRxiv - Microbiology 2020Quote: ... The expression of each anti-HIV-1 CAR was detected by protein L-biotin (GenScript) and Alexa488-conjugated anti-human Fc antibody or APC-conjugated anti-human Fc antibody as described elsewhere [78] ...
-
bioRxiv - Biochemistry 2021Quote: ... 15 μg total protein was loaded and resolved on Bis-Tris 4-12% gels (GenScript) and transferred to a polyvinylidene difluoride (PVDF ...
-
bioRxiv - Immunology 2022Quote: ... vaccines consisted of either SARS-CoV-2 Spike RBD WH-01 protein (GenScript; cat# Z03483) or SARS-CoV-2 WH-01 Spike protein (Acro Biosystems ...
-
bioRxiv - Microbiology 2021Quote: Microtiter plates (96-well; Thermo) were coated with 1 μg/mL S-2P protein (Genscript) corresponding to the S protein of the Wuhan-Hu-1 virus ...
-
bioRxiv - Molecular Biology 2021Quote: ... the supernatant containing the target proteins was loaded onto anti-FLAG G1 affinity resin (Genscript). The resin was washed using buffer A (20 mM Tris ...
-
bioRxiv - Microbiology 2021Quote: LAD2 cells (3×105) were incubated with Spike-RBD protein (5 μg/mL, Genscript, Z03483) in adherent buffer (1mM CaCl2 ...
-
bioRxiv - Immunology 2021Quote: ... The lysate was immunoprecipitated using designated primary antibodies with protein G resin (GenScript, Piscataway, NJ), or anti-Flag M2 affinity agarose gel at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... The SECphi4 56aa protein of unknown function was the only gene not synthesized by Genscript Corp ...
-
bioRxiv - Plant Biology 2022Quote: ... samples were run on a 4%-20% gradient protein gels (GenScript, SurePAGE, Cat. No. M00655) and stained with Fast Silver Stain Kit (Beyotime ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmids expressing the PABPN1- Flag (NM_004643) and THOC5-HA (NM_001002878.1) proteins were purchased from GenScript. Plasmid pcDNA-THOC1-HA was generated by cloning the THOC1 sequence from plasmid phHpr1-GST (Addgene #11200 ...
-
bioRxiv - Molecular Biology 2023Quote: ... whereas all other gels were stained using the eStain™ L1 protein staining system (GenScript). Precision Plus Protein™ standards (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2023Quote: ... Equal amounts of protein lysates were loaded onto SurePAGE Bis-Tris 4-20% gels (Genscript) and transferred either to
-
bioRxiv - Genetics 2023Quote: ... The protein samples were separated by SDS-PAGE (4-12% Bis-Tris gels, Genscript, #M41210C) with MOPS buffer (Tris-MOPS-SDS Running Buffer ...
-
bioRxiv - Cancer Biology 2023Quote: ... Protein coding sequences for PRMT1v1 (ENST00000391851.8) and PRMT1v2 (ENST00000454376.7) were ordered from GenScript (https://www.genscript.com) and PCR-cloned into pHIV-Luc-ZsGreen (Addgene plasmid #39196 ...
-
bioRxiv - Microbiology 2023Quote: ... the purified polyclonal antibodies against RNase E was bound to Protein A/G MagBeads (Genscript), followed by cross-linking using dimethyl pimelidate dihydrochloride (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... enterica Tsr LBD construct for recombinant protein expression was performed as a service by Genscript Biotech Corp ...
-
bioRxiv - Biophysics 2023Quote: ... Sup35NM was visualized using an antibody raised against residue 125-253 of the protein(GenScript). Cell lysates were fractionated by SDS-PAGE ...
-
bioRxiv - Microbiology 2023Quote: ... or 9 ug/mL of full-length FimH protein (antigen for custom antibody production, Genscript) was used.
-
bioRxiv - Cancer Biology 2024Quote: ... The expression of the CAR was detected using a biotinylated protein L (GenScript, Piscataway, NJ) antibody and streptavidin-coupled PE (BD Biosciences ...
-
bioRxiv - Bioengineering 2024Quote: PEG hydrogels were functionalized with the following peptides and proteins purchased from Genscript (Piscataway, NJ): RGDS ...
-
bioRxiv - Molecular Biology 2022Quote: ... Selected mouse IgG and IgK chains were cloned into humanized IgH and IgL vectors (Genscript).
-
bioRxiv - Developmental Biology 2023Quote: ... Dlx5 and Pbx1 coding sequences were amplified from mouse cDNA and cloned into pcDNA3.1 (Genscript). Meis2 vector was mutated with NEBuilder HiFi DNA Assembly kit (NEB ...