Labshake search
Citations for GenScript :
501 - 550 of 644 citations for Dog Trefoil Factor 3 TFF3 Protein since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: Primary antibodies against ApcG and ApcI were raised immunizing rabbits with the purified proteins (Supp. Figure S4) (Genscript). Bleedings from rabbits were used in dilutions of 0.25 mL into 1 mL of TBS-T ...
-
bioRxiv - Immunology 2024Quote: ... – BMDC of Pink1−/− mice were stained with Tag-it Violet as described previously and then coated on ice for 3 hours with the mitochondrial peptide pool (custom synthesis by Genscript or Canada Peptide) or mock pool (OVA 257-264 ...
-
bioRxiv - Developmental Biology 2023Quote: ... were also commercially synthesized with 5’EcoRV and 3’SpeI ends and cloned into the pCDNA3.1 vector by Genscript (Genscript USA, Piscataway, NJ). To construct the inducible GR-RFX6 wild type or mutants used in cycloheximide direct target assays ...
-
bioRxiv - Molecular Biology 2022Quote: ... The pL7-PfSMC3-3HA-glmS plasmid also contained the homology repair construct 5’- AGATAGAGAGAGTTATATATCTAAAGGAACAAAGAATGAGGCCTACGAAATTATTAGC ATTGTATAAAAAAAAAAAGAAAAAAAAAAGAAAAAAAAAAAAGATTATATATATAAT ATATGTTGACAATTAATAAATATATTTGTATATATCTGTTAACTAATTATGAAAATTTTT GAATCAATAAATTTTTTAAATAACAAAAAAAAAAAAAAATATATATATTATATATATA TTTTATATTTTATATTTTCTTGTAATTTTTGTTTTTTTAGGAGGAAAAACATGCCCTAGA AAATggcggtggaTACCCTTACGATGTGCCTGATTACGCGTAtCCcTAtGAcGTaCCaGAcTAtG CGTACCCtTAtGAcGTtCCgGATTAtGCtcacggggtgTAAGCGGCCGCGGTCTTGTTCTTATTTT CTCAATAGGAAAAGAAGACGGGATTATTGCTTTACCTATAATTATAGCGCCCGAACTA AGCGCCCGGAAAAAGGCTTAGTTGACGAGGATGGAGGTTATCGAATTTTCGGCGGATG CCTCCCGGCTGAGTGTGCAGATCACAGCCGTAAGGATTTCTTCAAACCAAGGGGGTGA CTCCTTGAACAAAGAGAAATCACATGATCTTCCAAAAAACATGTAGGAGGGGACAACA ATTTGGTTTTGTTTTTTTCTTTAGGTTTTGAGAAAAACAAATAGGAAATACAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAATGTATTTTTACATATGCACTTGGATTA TTTTATTTTTATTATTTTTCTTTATATAAAGTAAAAATATACATAAGTATGCTTATTTATT ACATAAGAGTTTATTTAAGAAAGGTTTCTTTTTCATAATATTGTGTGCATGAGTTTTTTT TTATTTTATTTTTTTTTTTTATTTCTGTAACGAAAAGGATATTAAAAAAAATAATAAAA- 3’ (synthesized by GenScript Biotech [Piscataway, NJ, USA]). This homology repair construct comprises a 3 x Hemaglutinin (3HA ...
-
bioRxiv - Biochemistry 2020Quote: ... Recombinant SARS-CoV-1 spike protein was obtained from SinoBiological and SARS-CoV-2 spike was obtained from Genscript and Acro Biosystems.
-
bioRxiv - Neuroscience 2020Quote: ... Cx26 DNA with the K125R mutation and omitted STOP codon (to allow for fusion proteins) was synthesised by Genscript USA from the Cx26 sequence (accession number NM_001004099.1) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... This 338aa protein fragment was then expressed in E.coli and used to immunize two rabbits for antibody production by GenScript. ELISA titer > 1:128,000 and target protein fragment binding validation by western blot and cell line overexpression.
-
bioRxiv - Microbiology 2021Quote: ... Production of FLAG-tagged transporter proteins was assessed by western blotting using anti-FLAG antibody (Genscript, Piscataway, NJ, USA) as described previously (5).
-
bioRxiv - Biochemistry 2022Quote: ... and SARS-CoV-2 Omicron Strain S gene Human codon_pcDNA3.1(+) expressing the spike protein of the Omicron variant (GenScript# MC_0101274) were used as indicated.
-
bioRxiv - Microbiology 2022Quote: ... The protein was then eluted with 1 CV of FLAG resin buffer supplemented with 0.2 mg/mL FLAG peptide (Genscript) after incubating with the elution buffer for 5 min on ice ...
-
bioRxiv - Microbiology 2022Quote: ... and the protein was eluted with 10 mL of Buffer A supplemented with 0.2 mg/mL FLAG peptide (Genscript). The eluate was further purified by size exclusion chromatography (SEC ...
-
bioRxiv - Biochemistry 2020Quote: cDNAs encoding the SARS-CoV and SARS-CoV-2 spike proteins were human codon optimized and synthesized by Genscript. cDNA encoding human ACE2 was obtained from MGC clone 47598 ...
-
bioRxiv - Immunology 2022Quote: ... nanobodies containing human IgG1 Fc in the culture supernatant were captured by AmMag Protein A Magnetic Beads (Genscript L00695) and eluted by Glycine pH 3.0 ...
-
bioRxiv - Synthetic Biology 2021Quote: Coding sequences of all tested IspG proteins were ordered codon optimized and cloned in a pET28a(+) plasmid by Genscript. A Tobacco etch virus (TEV ...
-
bioRxiv - Microbiology 2020Quote: ... Supernatants were recovered and 20 μg protein were separated on SurePAGE Bis-Tris 4-12% gradient gel following the manufacturer’s instructions (Genscript). A protein standards ladder (BioRad #1610374 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Protein purification columns were washed with 25 mL 1X PBS pH 7.0 before adding 2 mL Protein A resin (GenScript) and then washed with 25 mL 1X PBS ...
-
bioRxiv - Immunology 2021Quote: The following reagents were used in the study: recombinant SARS-CoV-2 spike S1 protein (GenScript Cat. No. Z03501), TLR9 agonists CpG-ODN 1826 (Invivogen ...
-
bioRxiv - Biochemistry 2020Quote: Western blot analyses of protein samples were performed as described previously for rabbit anti-Tse1 (diluted 1:5,000; Genscript), rabbit anti-FLAG (diluted 1:5,000 ...
-
bioRxiv - Immunology 2021Quote: ... The coding sequence for the consensus protein sequence was then codon-optimized for mammalian expression and synthesized by GenScript USA Inc (Piscataway ...
-
bioRxiv - Cell Biology 2022Quote: ... The C-terminal BAP tag of localized mitosomal proteins was detected by a rabbit anti-BAP polyclonal antibody (GenScript). Mitosomal marker GL50803_9296 was detected by a rabbit anti- GL50803_9296 polyclonal antibody (3) ...
-
bioRxiv - Microbiology 2022Quote: ... hACE2-Fc was produced in Expi293F cells and purified from the clarified culture supernatant using Protein G-Agarose (Genscript) followed by SEC on a Superdex 200 16/600 column linked to an AKTApure instrument (Cytiva) ...
-
bioRxiv - Plant Biology 2022Quote: ... The immunoprecipitated proteins were separated by SDS-PAGE electrophoresis and detected by anti-GST (A00865-200, 1:5,000, Genscript) and anti-MBP (E8032 ...
-
bioRxiv - Biochemistry 2024Quote: ... the cells were spun down at 4000 g for 30 min at 4 °C and GLA protein was purified by batch binding with 2.5 mL of Anti-DYKDDDDK G1 Affinity Resin (L00432, Genscript) in the harvested and 0.8 μm filtered supernatant ...
-
bioRxiv - Immunology 2022Quote: Human codon-optimized sequences of the ectodomain of SARS-CoV-2 spike protein (Wuhan Hu-1 complete genome, GenBank: MN908947.1) was synthesized by GenScript, Piscataway ...
-
bioRxiv - Biochemistry 2022Quote: Constructs to express FLAG-MTID or its fusions to AR WT and 22YtoS fusion proteins were synthesized by Genscript and either cloned into pcDNA3.1(- ...
-
bioRxiv - Biophysics 2022Quote: Fusion peptide domains (FP1, FP2 and FP1-FP2) of the SARS-CoV-2 spike protein were synthesized by GenScript with a purity ≥ 95% ...
-
bioRxiv - Immunology 2023Quote: ... was constructed based on the sequence Fc.Mut24 published by Khoryati et al.13 The protein was manufactured by Genscript, using its proprietary CHO mammalian expression system ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The sialic acid synthase protein (NCBI accession # XP_021429200) was commercially produced using the insect expression vector pFastBac1 (GenScript U488UFB180).
-
bioRxiv - Biophysics 2024Quote: ... The construct used for the Fast Protein Liquid Chromatography (FPLC) is as follows: full-length MP20 cloned to the plasmid pcDNA3.1(+) (Genscript) with a C-terminal his tag and flag tag.
-
bioRxiv - Microbiology 2024Quote: ... The supernatant was filtered through a 0.45 µm filter and the recombinant protein was purified using Ni-charge resin (GenScript). Further purification was achieved by size exclusion chromatography (SEC ...
-
bioRxiv - Immunology 2024Quote: Antibodies were then purified using 1- to 2-mL of protein A or G resin (Genscript L00210 and L00209) with gravity columns (Bio-Rad 7321010) ...
-
bioRxiv - Microbiology 2024Quote: Viral G protein-coupled receptor (vGPCR) gene sequences were obtained from the AD169 viral genome and synthesized by GenScript. Synthesized vGPCRs were inserted into puc-57 plasmids incorporating a Kozak sequence upstream of the translational start site and a FLAG-tag (DYKDDDDK ...
-
bioRxiv - Biochemistry 2024Quote: ... followed by protein elution by addition of Wash Buffer supplemented either with 0.25 mg-1ml-1 1D4 peptide (GenScript) or a 1:10 w:w ratio of 3C protease for on-column cleavage and incubated overnight at 4 °C on a roller for tag cleavage ...
-
bioRxiv - Cancer Biology 2024Quote: ... have been previously described.7,17,18 The same SB vector encoding a V5 epitope-tagged full-length murine Gas1 protein was synthesized by GenScript Biotech (Piscataway ...
-
bioRxiv - Biophysics 2021Quote: ... CCKAR–G protein complexes were assembled at room temperature (RT) for 1 h by the addition of 10 μM CCK-8 (GenScript) and 25 mU/mL apyrase ...
-
bioRxiv - Immunology 2021Quote: ... Peptide pools consisted of 15-mer peptides overlapping by 11 amino acids and spanned the entire S and N proteins of SARS-CoV-2 (GenScript). After stimulation ...
-
bioRxiv - Immunology 2021Quote: ... The splenocytes were stimulated for 20 hours at 37°C with RBD peptides (15-mer peptides overlapping by 9 amino acid spanning the RBD of SARS-CoV-2 spike protein, GenScript), at 5μg/mL of each peptide in RPMI + 10% FBS (R10) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Equal amounts of protein (nominally 50 μg) from each sample were separated on 4-20% gradient Bis-Tris SDS-PAGE gels (GenScript), and protein was then electroblotted onto low autofluorescence PVDF membrane (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The purified FLAG-tagged proteins were cleaved from MBP or Glutathione S-transferase (GST) using 3C protease (Genscript #Z03092-100) and their purity was analyzed by SDS-PAGE.
-
bioRxiv - Plant Biology 2020Quote: ... The protein was purified using GST-tag affinity and used directly as an antigen in rabbits (Genscript, Piscataway, NJ, USA). The resulting antiserum was used at a dilution of 1:30.000 ...
-
bioRxiv - Plant Biology 2020Quote: ... The pellet was discarded and the supernatant employed for Co-IP analysis using polyclonal specific antibody against the whole FBN2 protein (produced by GENSCRIPT) and Dynabeads Co-Immunoprecipitation Kit (Life Technologies ...
-
bioRxiv - Biophysics 2020Quote: ... Recombinant nucleocapsid protein of SARS-CoV-2 (Catalog No: Z03488- 1) and SRPK1 kinase (Catalog No: PV4215) were purchased from GenScript andThermoFisher ...
-
bioRxiv - Cancer Biology 2021Quote: ... CAR T cells were evaluated for CAR expression on the surface by flow cytometry with protein L (1:100; M00097, Genscript) as previously described(47) ...
-
bioRxiv - Neuroscience 2022Quote: ... Proteins were transferred to PVDF membranes with the eBlot® L1 system using eBlot® L1 Transfer Stack supports (Genscript) and the resulting membranes were washed three times with TBS-T (Tris-buffered saline containing 0.1 % Tween® 20 (Merk)) ...
-
bioRxiv - Biochemistry 2022Quote: Substrate phosphorylation time course assays with PKD1ULD-5G/10G-KD were performed on ice with 50 nM protein and 100 µM biotinylated Syntide2 (biotin-PLARTSVAG (GenScript)) ...
-
bioRxiv - Microbiology 2022Quote: ... cells were incubated with pooled peptides of SARS-CoV-2 spike (15-mer peptides with 11aa overlap covering the entire spike protein; GenScript) and cultured at 37°C with 5% CO2 for 20 hours ...
-
bioRxiv - Immunology 2022Quote: ... Peptide pools consisted of 15-mer peptides overlapped by 11 amino acids and spanning the entire S and N proteins of SARS-CoV-2 (GenScript). After stimulation ...
-
Sterilizing immunity against SARS-CoV-2 in hamsters conferred by a novel recombinant subunit vaccinebioRxiv - Microbiology 2020Quote: ... cells were incubated with pooled peptides of SARS-CoV-2 spike (15-mer peptides with 11 amino acids overlap, cover the entire spike protein, Genscript) and cultured for 20 hours ...
-
bioRxiv - Biochemistry 2021Quote: ... The supernatant fraction was then incubated with 5 μg of the indicated antibodies and protein A-agarose beads (GenScript L00210) at 4°C on a nutator for 5 h ...
-
bioRxiv - Biochemistry 2021Quote: ... gene was codon-optimized and cloned into the p423_GAL1 yeast expression vector as an N-terminal Flag (DYKDDDDK) and C-terminal decahistidine (10X His) tagged fusion protein (GenScript) (Fig ...