Labshake search
Citations for GenScript :
501 - 550 of 1166 citations for Acetamide N 2 3 dihydro 2 3 hydroxy 2 quinolinyl 1 3 dioxo 1H inden 5 yl since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... or pcDNA-(+)-N-DYK vector for nsp2 (Genscript). An N-terminal truncation nsp3.1-FT (residues 1-749 ...
-
bioRxiv - Immunology 2024Quote: ... Samples above the cutoff of nucleocapsid (GenScript N) and spike (Mt ...
-
bioRxiv - Microbiology 2023Quote: ... SARS-CoV-2 spikes or their N-to-Q or N-to-A substituted variants were codon optimized and cloned into pcDNA3.1(+) plasmid (GenScript, Piscataway, NJ). The HIV gag/pol (pCMVΔR8.2 ...
-
bioRxiv - Molecular Biology 2020Quote: Codon optimized Gcn5 (S. pombe) with 1 × FLAG was cloned into pET28a in frame with N terminal 6 × HIS tag by GenScript to generate JP-2587.
-
bioRxiv - Biophysics 2022Quote: ... construct cloned in a pGEX-6P-1 vector with an N terminal GST-tag followed by a precision protease site was obtained from GenScript.
-
bioRxiv - Cell Biology 2024Quote: ... was established from screening hybridomas generated from mice immunized with purified N-terminus of mouse CATSPER1 (1-150 aa; GenScript) followed by Protein G affinity purification.
-
bioRxiv - Biochemistry 2020Quote: ... or N-terminal poly-histidine-tag (Genscript, codon-optimized) was expressed in E ...
-
bioRxiv - Biophysics 2023Quote: ... and N (GenBank: NC_045512.2) genes were synthesized by Genscript, Inc ...
-
bioRxiv - Neuroscience 2024Quote: ... APEX2-HTT N-terminal fusions were generated by GenScript. HEK293 cells were transfected with APEX2-HTT-23Q and APEX2-HTT-82Q plasmids (using Lipofectamine 2000 ...
-
bioRxiv - Microbiology 2024Quote: ... and N-WASP CRIB mutant were generated by GenScript. pCS2+MT-hTOCA-1 WT ...
-
bioRxiv - Microbiology 2024Quote: ... and TmeB were cloned into pcDNA3.1+N-eGFP (Genscript) using KpnI or NotI/XbaI sites ...
-
bioRxiv - Biochemistry 2020Quote: ... N-terminal CSF and “tethered” peptides were synthesized by GenScript. Chimeric G protein yeast strains were provided by GSK under material transfer agreement.
-
bioRxiv - Biochemistry 2020Quote: ... and a C-terminal TAMRA label (N-AAARKKRRQRRR-C, Genscript), and MerMade-synthesized unlabeled HIV-1 TAR ...
-
bioRxiv - Immunology 2023Quote: ... Plasmids encoding N-terminal domain proteins were obtained from GenScript. Plasmids were transiently co-transfected in FreeStyle 293-F cells using 293Fectin (ThermoFisher) ...
-
bioRxiv - Biochemistry 2024Quote: ... p41 with iRFP on N-terminal in pcDNA3.1(+) by Genscript U.S.A ...
-
bioRxiv - Cancer Biology 2021Quote: ... The primary antibodies used were, anti-p-Smurf2Thr249 (#J1683BA260-5, 1:2000) (GenScript), anti-Phospho-Smad2 (Ser465/467 ...
-
bioRxiv - Biophysics 2021Quote: ... Human l-Opa1 (isoform 1) and s-Opa1 with Twin-strep-tag at N-terminus and deca-histindine tag at C-terminus (GenScript, NJ, USA) was expressed in Pichia pastoris strain SMD1163 ...
-
bioRxiv - Molecular Biology 2020Quote: ... HRAS and NRAS gene sequences (residues 1–166, with an N-terminal His-tag and C-terminal BAP-tag were synthesized by GenScript (Piscataway, USA) and cloned into pET11a ...
-
bioRxiv - Cancer Biology 2021Quote: ... that contains a N-terminal His TEV cleavage tag by Genscript. Protein expression was carried out in Escherichia coli C41(DE3) ...
-
bioRxiv - Biophysics 2020Quote: N-terminally formylated PSM peptides (> 95% purity) were purchased from GenScript Biotech ...
-
bioRxiv - Microbiology 2022Quote: ... M and N with respective promoters were synthesized commercially (GenScript, USA) and cloned in pBacPAK9 with restriction sites BamHI and EcoRI ...
-
bioRxiv - Molecular Biology 2023Quote: ... Peptides containing an N-terminal biotin tag were purchased from GenScript and dissolved according to manufacturer’s recommendation ...
-
bioRxiv - Biochemistry 2024Quote: N-terminally biotinylated synthetic FLAG peptide variants were ordered from Genscript. These were dissolved in SPR buffer (150 mM NaCl ...
-
bioRxiv - Cell Biology 2024Quote: 0.6pmol (∼1.6ug) pUC57-Halotag-N-YAP1 plasmid (custom made by Genscript, containing 400bp/ea homology arms flanking YAP1 (NM_001130145.3 ...
-
bioRxiv - Biochemistry 2024Quote: ... and cloned into a pGEX-6P-1 plasmid containing an N-terminal GST tag and a PreScission Protease cleavage site (GenScript, Piscataway, NJ, USA). The plasmid was transformed into E ...
-
bioRxiv - Molecular Biology 2020Quote: ... USP7 was expressed with an N-terminal myc-tag from pcDNA3.1 (Genscript). All mutations were generated by Genscript ...
-
bioRxiv - Molecular Biology 2023Quote: ... were expressed in the pMA vector (pMA-SthCas6-4xcrRNA-N-gene, GenScript). Cas10 gene with 15HD>HA and 573GGDD>GGAA mutations was synthesized and cloned in pACYCDuet1-SthCas10-SthCsm2 plasmid using NcoI and NotI restriction sites ...
-
LRP1 mediates leptin transport by coupling with the short-form leptin receptor in the choroid plexusbioRxiv - Neuroscience 2023Quote: ... and pcDNA3.1(+)-N-HA-mLepR (mouse LepR isoform A CDS; NM_001122899.2, Genscript) using Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... Mutagenesis to NLS-like sequences in N-protein was performed by GenScript. Nsp1 mutations K164A/H165A were previously shown to disable nsp1-mediated host gene shut-off [42] ...
-
bioRxiv - Microbiology 2024Quote: ... an N-terminally biotinylated PbpCaa1-13 peptide (Biotin-Ahx-MNDWTLPPYKFDD; GenScript, USA) was immobilized on the sensor ...
-
bioRxiv - Biophysics 2020Quote: The gene corresponding to residues 1-201 of colicin 5 (colE5-T) was synthesized (GenScript) and cloned into pET21(+ ...
-
bioRxiv - Biochemistry 2024Quote: ... PDZbm cargo peptide 5-HT4(a)R-pS-5 (Phosphorylated at Serine -5 position; commercially synthesized from Genscript) was dissolved in 20 mM Hepes (pH 7.5) ...
-
bioRxiv - Immunology 2021Quote: ... and S1 subunit (0.5 µg/mL) (cat n° Z03501, GenScript, Piscataway, NJ, USA) purified recombinant proteins dissolved in carbonate-bicarbonate buffer (pH 9.6 ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were probed overnight at 4°C for SEOV N protein (custom, Genscript) at dilution 1:400 in 1xPBS and with secondary antibody AlexaFluor 555 goat α mouse (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were probed overnight at 4°C for SEOV N protein (custom, Genscript) at dilution 1:400 in 1xPBS and with secondary antibody AlexaFluor 555 goat α mouse (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... Proteins were used to test activity in vitro against N- terminal peptides (Genscript) using 5,5-dithio-bis-(2-nitrobenzoic acid ...
-
bioRxiv - Microbiology 2023Quote: The short labelled RNAs 5’ p-LU13-FAM (5’ p-GAGACAGUAUUUG-FAM) and 5’ OH-LU13-FAM (5’ OH-GAGACAGUAUUUG-FAM) were chemically synthesized by Genscript Biotech Corporation ...
-
bioRxiv - Synthetic Biology 2022Quote: ... carrying 5’-GCAATGCGTATCATTCTGCT and 5’-GCCGTCAACTTTCGCGTATT guide sequences (from GenScript USA Inc.). Positive colonies were selected by screening colonies with allele-specific PCR (Supplementary Table 4 ...
-
bioRxiv - Immunology 2023Quote: sgRNAs (PD-L1: 5’TCTTTATATTCATGACCTAC; CD155: 5’CCCGAGCCATGGCCGCCGCG) were chemically synthesized (GenScript). Ribonucleoproteins (RNPs ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA copy number/mL supernatant was assessed using pCDNA3.1(+)-N-eGFP plasmid (GenScript) as standard.
-
bioRxiv - Biochemistry 2021Quote: The gene for N102LT N-terminally fused with tagRFP (gi: 336287738) was synthesised (GenScript) and inserted to unmodified pQlinkN plasmid using restriction enzyme cloning ...
-
bioRxiv - Biochemistry 2022Quote: ... The sequence encoding mouse alpha-DG N terminal domain(a-DGN) was synthesized (Genscript) and cloned into the AAV backbone under the transcriptional control of the ubiquitous CMV promoter ...
-
bioRxiv - Microbiology 2023Quote: Synthetic peptides of P covering the sequence N-EDDIYQLIM-C were obtained from GenScript. The peptide was dissolved in deionised water dosed with a drop of 5 M NH4OH to improve solubility ...
-
bioRxiv - Immunology 2024Quote: ... and N genes were integrated into a lentiviral expression plasmid (pGenlenti vector) from Genscript, UK ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were then probed for SEOV N (α SEOV nucleocapsid, custom generated with Genscript) or HTNV N (anti-HTNV nucleocapsid 76–118 ...
-
bioRxiv - Immunology 2023Quote: ... were coated with 1 μg/mL (for IgG) or 5 μg/mL (for IgA) S-2P protein (GenScript), corresponding to the spike protein of the Wuhan-Hu-1 virus stabilized with 2 proline mutations ...
-
bioRxiv - Biophysics 2022Quote: ... All constructs were designed with GFPmut1 fused to the N-terminus and synthesized by GenScript. The plasmids were electroporated into P ...
-
bioRxiv - Molecular Biology 2020Quote: ... The pcDNA3.1-FLAG-FNIP1 and the pcDNA3.1+N-eGFP-FLCNΔE510 vectors were generated by Genscript. The pIRES2-FLCN plasmids were kindly provided by Dr ...
-
bioRxiv - Biophysics 2020Quote: ... and FEZ1 peptide (M174-L188, with N-terminal extension containing a cysteine residue (KCGGSGGMMQNSPDPEEEEEVL, Genscript) were labelled with Alexa Fluor 488-C5-maleimide at 1:1 molar ratio in 50 mM Tris ...
-
bioRxiv - Immunology 2024Quote: ... Fine epitope mapping was performed by ordering synthetic peptides with N-terminal biotin residues (Genscript: 17-mer YHHHHHHDYDIPTTENL ...