Labshake search
Citations for GenScript :
501 - 550 of 991 citations for 5 Azepane 1 sulfonyl 2 methoxy benzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: Blocking of the RBD-ACE2 interaction by the mouse sera was assessed using a SARS-CoV-2 Surrogate Virus Neutralization Test Kit (Genscript) (Tan et al ...
-
bioRxiv - Immunology 2020Quote: The three epigraph HA and wildtype A/swine/Texas/4199-2/1998 HA immunogens were codon-optimized for swine gene expression and synthesized by GenScript. These genes were cloned into an Adenovirus type 5 replication-defective E1/E3 deleted vector using the Ad-Easy Adenoviral Vector System (Agilent) ...
-
bioRxiv - Immunology 2020Quote: The human codon optimized cDNA of the SARS-CoV-2 spike protein (MC_0101081) was purchased from GenScript (Piscataway, NJ, USA). The human ACE2 cDNA was derived from MGC clone 47598 ...
-
bioRxiv - Microbiology 2022Quote: ... The N-terminal domain (Delta-like) of the SARS-CoV-2 Delta-Omicron recombinant spike was chemically synthesized as a short fragment (Genscript) and fused by overlapping PCR with the RBD and C-terminal parts of the BA.1 spike ...
-
bioRxiv - Biochemistry 2023Quote: Human Mint1 sequences for bacterial expression were codon optimised and sub-cloned into the pGEX4T-2 plasmid by Genscript (USA). The constructs generated were GST-tagged Mint1(226- 314)(MID) ...
-
bioRxiv - Immunology 2024Quote: Total IgG was from 3 mL human serum from a patient vaccinated against SARS-CoV-2 using protein G agarose resin (Genscript). Protein G resin was washed with PBS and eluted with 0.1M glycine buffer ...
-
bioRxiv - Biophysics 2024Quote: 5X repeat Nck SH3 domain 2 (polySH3) and 5X repeat Abl PRM (polyPRM) codon-optimized genes were purchased from GenScript and cloned into a pMal plasmid to generate fusion proteins with an N-terminal Maltose Binding Protein (MBP ...
-
bioRxiv - Developmental Biology 2023Quote: ... 0.25% DMSO) (refer to Fig. 1C) in the presence or absence of SARS-CoV-2 spike protein (5ng/mL; GenScript). Controls were kept in the treatment solution with only DMSO ...
-
bioRxiv - Biochemistry 2023Quote: Remaining samples of sera from corresponding administration routes along with prebleed samples were pooled and passed through a protein A column and the recovered IgGs used in SARS-CoV-2 surrogate virus neutralisation assays (sVNT) 38 using a commercial kit (GenScript).
-
bioRxiv - Immunology 2023Quote: ... 96-well plates were coated with 2 μg/mL of recombinant Karp type-specific antigen 56 (TSA56, generated by Genscript) in PBS and blocked with 1% BSA ...
-
bioRxiv - Immunology 2023Quote: ... SARS-CoV-2 sequences (Genbank accession number MN908947) were codon-optimized for Chinese Hamster Ovary (CHO) cells and synthesized by GenScript. Within the construct ...
-
bioRxiv - Immunology 2023Quote: DNA fragments that encode SARS-CoV-2 variant RBD (Spike 319-541) were codon-optimized for human cell expression and synthesized by Genscript. His-AVI tags were added at the end of the fragments ...
-
bioRxiv - Immunology 2023Quote: A commercially available kit to quantify the ability of the three pAbs to neutralize the binding of RBD to ACE-2 was obtained from GenScript, Piscataway NJ (kit #L00847) ...
-
bioRxiv - Bioengineering 2023Quote: ... mouse spleen cells were stimulated with 2 μg/ml S1、S2 peptide pools spanning SARS-CoV-2 spike S1 and S2 respectively (15mers, overlapping by 11aa, GenScript) or equimolar amount of DMSO (negative control ...
-
bioRxiv - Immunology 2024Quote: DNA fragments that encode SARS-CoV-2 variant RBD (Spike 319-541) were codon-optimized for human cell expression and synthesized by Genscript. His-AVI tags were added at the end of the RBD gene fragments ...
-
bioRxiv - Microbiology 2024Quote: Plasmids encoding full-length or truncated proteins from SARS-COV-2 (clinical isolate Australia/VIC01/2020) tagged at the N-terminus with eGFP were generated by GenScript in pcDNA 3.1-N-eGFP ...
-
bioRxiv - Microbiology 2024Quote: ... Peptide cleavage reporter assays were prepared by combining 1 µL of PsCaspase cell lysates with 2 µL of 100 µM synthetic 7-amino-4-methylcoumarin (AMC)-conjugated peptides (Genscript) and 5 µL of 100 mM sodium phosphate buffer (pH 7.4 ...
-
bioRxiv - Plant Biology 2024Quote: MtAPI and MtHAPI1 mCitrine-tagged variants were synthesised with flanking Gateway-compatible attL1/2 sites and cloned into pUC57 by Genscript. The mCitrine CDS was inserted with a short N-terminal linker sequence (linker-mCitrine ...
-
bioRxiv - Plant Biology 2024Quote: ... 0.2 uM of 6xHis-SUMO-UBA and GST/GST-ERC1 FL were incubated with Ni-Charged NTA magnetic resins (GenScript) in the reaction buffer (50mM imidazole ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Plates were coated ON at 4 °C with 2 µg/mL mouse anti-human IgG Fc (Genscript, Piscataway, NJ, USA) in PBS ...
-
bioRxiv - Biochemistry 2024Quote: ... non-targeting sgRNA (TGCTTTACCGCGTTGGGTAA) or CLYBL targeting sgRNA (exon 2: CATAGAGCACTGCTCTCCGG; exon 3: AGACTTTGACCTGGGCACAA; exon 4: CCATTGCAGTCTCCACAAAG) were purchased from Genscript. Plasmids were transformed into OneShot™ E ...
-
bioRxiv - Biochemistry 2024Quote: ... Supernatant from centrifugation at 12000 rpm for 45 min was applied to 2 mL of Anti-DYKDDDDK G1 Affinity Resin (GenScript) which was washed five times by 5 mL of wash buffer I (25 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Expression constructs encoding ERBB4 JM-a CYT-2 point mutants listed in Supplementary Table S1 were created by cloning mutant inserts from pDONR221-vectors (Genscript) into pBABE-puro-gateway retroviral mammalian expression vector (a gift from Matthew Meyerson ...
-
bioRxiv - Bioengineering 2024Quote: ... Modified synthetic sgRNAs (2’-O-methyl-3’phosphorothioate linkage modifications in the first and last three nucleotides) were purchased from Genscript. sgRNA concentration was calculated using the full-length product reporting method ...
-
bioRxiv - Biochemistry 2024Quote: The TRI2-2 and influenza virus minibinders were cloned into pET29b between the NdeI and XhoI restriction sites by Genscript. The TRI2-2 minibinder was cloned with a C-terminal polyhistidine tag and the influenza minibinder was cloned with an N-terminal polyhistidine tag17 ...
-
bioRxiv - Developmental Biology 2023Quote: ... were also commercially synthesized with 5’EcoRV and 3’SpeI ends and cloned into the pCDNA3.1 vector by Genscript (Genscript USA, Piscataway, NJ). To construct the inducible GR-RFX6 wild type or mutants used in cycloheximide direct target assays ...
-
bioRxiv - Cell Biology 2022Quote: ... GRGDSPC peptide (1% w/v) (Genscript) was added to the solution ...
-
bioRxiv - Molecular Biology 2020Quote: ... anti-GFP (1:1000) (GenScript, A01704) anti-MRG-1 (1:1000 ...
-
bioRxiv - Biophysics 2020Quote: ... MEC-10 and DEGT-1 (GenScript) in the pGEM-HE oocyte expression vector (Liman et al. ...
-
bioRxiv - Microbiology 2021Quote: ... CSP-1 (GenScript, New Jersey, USA), as previously described (36) ...
-
bioRxiv - Cell Biology 2022Quote: ... or GST (1:500, Genscript A00865), followed by 1:3000 HRP-conjugated Goat anti-rabbit or Goat anti-mouse secondary antibodies (Bio Rad) ...
-
bioRxiv - Immunology 2022Quote: ... and 1 μM TPI peptide (Genscript).
-
bioRxiv - Biophysics 2022Quote: ... and 1 μM TPI peptide (Genscript) for surface expression of TPI:HLA-DR1 ligand for the E8 TCR.35
-
bioRxiv - Developmental Biology 2022Quote: ... DUXBL (1:500, custom antibody, GenScript), HDAC1 (1:100 ...
-
bioRxiv - Molecular Biology 2023Quote: ... FLAG (1:1,000 (A00187, GenScript, RRID:AB_1720813)) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Mouse anti-V5 (1:10,000; Genscript), Anti-V5 tag antibody [SV5-P-K](1:5,000 ...
-
bioRxiv - Molecular Biology 2024Quote: Purified Aβ42 (Genscript, Cat# RP20527-1), was solubilized in 1% NH3 at 12.5mg/ml then diluted to 1mg/ml in PBS ...
-
bioRxiv - Bioengineering 2024Quote: ... additionally CRGDS peptide (1 mM, GenScript) was added for cell adhesion ...
-
bioRxiv - Biochemistry 2024Quote: Protein A resin (1 mL, GenScript) was prepared by washing with 25 mL TBS in a gravity purification column ...
-
bioRxiv - Biochemistry 2024Quote: ... anti-Strep (Genscript, A01732, 1:1000), goat anti-rat IgG (Thermo Scientific ...
-
bioRxiv - Immunology 2021Quote: ... Antigens included recombinant SARS-CoV−2 RBD protein obtained from the Saphire laboratory at LJI or recombinant nucleocapsid protein (GenScript Z03488). The next day ...
-
bioRxiv - Cancer Biology 2021Quote: ... The lysate was heated at 95°C for 5 min and centrifuged at 10000 rpm/s for 2 min to remove the insoluble material prior to SDS-PAGE in a 4-20% gradient ExpressPlus™ PAGE Gels (Genscript) at constant 120 V for 1 h ...
-
bioRxiv - Microbiology 2021Quote: Codon-optimized full-length open reading frames of the S genes of SARS-COV-2 variants were cloned into pcDNA3.1(+) or pVRC8400 by GenScript (Piscataway, NJ). The spikes of variants used in this study were listed in Table 1 ...
-
bioRxiv - Microbiology 2021Quote: ... of SARS-CoV-2 spike protein to Angiotensin Converting Enzyme (ACE2) was assessed via the Surrogate Virus Neutralization Test (GenScript# L00847) using the included kit protocol modified per the following ...
-
bioRxiv - Microbiology 2020Quote: ... Target proteins were obtained with purity >85% and endotoxin level <2 EU/mg (LAL Endotoxin Assay Kit, GenScript, Cat. No. L00350). In addition ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Plasmid pcDNA3-PLpro-flipGFP-T2A-mCherry was constructed from pcDNA3-TEV-flipGFP-T2A-mCherry.15 SARS-CoV-2 PLpro expression plasmid pcDNA3.1-SARS2 PLpro was ordered from Genscript (Piscataway NJ) with codon optimization ...
-
bioRxiv - Immunology 2022Quote: ... were coated overnight with 250 ng/well of purified recombinant Coronavirus proteins and 500 ng/well of a SARS-CoV-2 fusion sequence-containing peptide (KRSFIEDLLFNKVTLADAGFIK, GenScript Biotech). After washings with 0.05% Tween 20-PBS (washing buffer) ...
-
bioRxiv - Biophysics 2020Quote: SARS CoV-2 main protease (Mpro or 3CL) gene from strain BetaCoV/Wuhan/WIV04/2019 was ordered from GenScript (Piscataway, NJ) in the pET29a(+ ...
-
bioRxiv - Molecular Biology 2020Quote: ... AGO1/2 and AGO1/2/3 knockout cell lines used for RNAseq were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...
-
bioRxiv - Immunology 2021Quote: Antibodies inhibiting virus binding to host cell was measured using a commercial RBD-human angiotensin-converting enzyme 2 (hACE2) binding inhibition assay called cPASS™ (GenScript). As per manufacturer’s instructions ...