Labshake search
Citations for GenScript :
501 - 550 of 1115 citations for 1 4 Bis acetyloxy 3 dodecylsulfanyl 2 naphthyl acetate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: The above assay was performed using SARS-CoV-2 sVNT ready to use kit by Genscript, which is a competition ELISA (4) ...
-
bioRxiv - Microbiology 2024Quote: ... The supernatant was applied onto a self-packaged Ni-affinity column (2 mL Ni-NTA, Genscript) and contaminant proteins were removed with washing buffer (50 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Immunology 2024Quote: ... Mice were immunized with SARS-CoV-2 Spike protein (5 µg, Val16-Pro1213, wild type, Genscript) with Alhydrogel® adjuvant 2% (InvivoGen ...
-
bioRxiv - Immunology 2024Quote: ... Cells were stimulated with an overlapping peptide pool derived from SARS-CoV-2 Spike protein (Genscript). Following 2 hours of culture ...
-
bioRxiv - Biochemistry 2024Quote: ... The cleared lysate was incubated with 2 ml of MonoRab anti-DYKDDDDK Affinity Resin (L0076; GenScript) for 30 minutes ...
-
bioRxiv - Bioengineering 2024Quote: ... and 35 kPa (7% 20 kDa 8-arm PEG-NB, Creative PEGworks; 2 mM RGD, Genscript). Flat bottom hydrogels were fabricated by first plasma treating µ-slides 8 well (Ibidi USA ...
-
bioRxiv - Developmental Biology 2020Quote: ... Dkk-1 (GenScript) was added to BM at final concentration of 100 ng/ml ...
-
bioRxiv - Neuroscience 2024Quote: ... FAT-1 (Genscript), and FAT-2 (Genscript ...
-
bioRxiv - Microbiology 2024Quote: ... 1 (Genscript Biotech). Additionally ...
-
bioRxiv - Developmental Biology 2023Quote: ... were also commercially synthesized with 5’EcoRV and 3’SpeI ends and cloned into the pCDNA3.1 vector by Genscript (Genscript USA, Piscataway, NJ). To construct the inducible GR-RFX6 wild type or mutants used in cycloheximide direct target assays ...
-
bioRxiv - Immunology 2024Quote: ... – BMDC of Pink1−/− mice were stained with Tag-it Violet as described previously and then coated on ice for 3 hours with the mitochondrial peptide pool (custom synthesis by Genscript or Canada Peptide) or mock pool (OVA 257-264 ...
-
bioRxiv - Genomics 2021Quote: ... Ada2b (rabbit polyclonal, 1:1000; GenScript anti-amino-acid 1-330); anti-Flag-horseradish peroxidase (mouse ...
-
bioRxiv - Microbiology 2020Quote: ... Blocking buffer was removed and replaced with 20 mL blocking buffer supplemented with 4 μL anti-HIS primary antibody (mAb, mouse, GenScript®) and the blot was incubated overnight at 4°C with agitation ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Lysates were mixed with Native-PAGE sample buffer 5X (Beyotime) and subjected to Native-PAGE using ExpressPlus™ 4-12% PAGE Gel (GenScript) and Tris-MOPS-SDS Running Buffer (GenScript) ...
-
bioRxiv - Microbiology 2021Quote: ... and 20 μg of protein lysates from each sample were denatured in 4X LDS sample buffer followed by separation on 4–12% gradient SDS PAGE polyacrylamide gel (Genscript, #M00653). Separated proteins on the polyacrylamide gel were transferred to a 0.2 μm PVDF membrane (Thermo Scientific ...
-
bioRxiv - Biochemistry 2023Quote: ... was used to measure total protein content to enable equal loading of protein onto 4-12% precast mini polyacrylamide gels (SurePAGE™, GenScript). Proteins were transferred onto polyvinyl difluoride (PVDF ...
-
bioRxiv - Biochemistry 2024Quote: ... Cell debris were removed by centrifugation (10,000 x g for 10 min at 4°C) and the supernatant was incubated with 30 μL of protein A/G-coated magnetic beads (Genscript L00277) for 1 hour at 4 °C to remove nonspecifically bound proteins ...
-
bioRxiv - Molecular Biology 2022Quote: Equal sample concentrations (100 μg of total protein per well) were resolved in 4%–20% electrophoresis gradient gels (Genscript, Cat. M00656) and transferred onto polyvinylidene difluoride (PVDF ...
-
bioRxiv - Biophysics 2024Quote: Samples were quenched using 4X non-reducing Laemmli SDS sample buffer (TPpro, Taiwan) and then separated on 4-20% gradient SDS gels (GenScript, USA). Visualization of protein bands was carried out using an iBright FL1000 system (ThermoFisher ...
-
bioRxiv - Molecular Biology 2022Quote: ... The pL7-PfSMC3-3HA-glmS plasmid also contained the homology repair construct 5’- AGATAGAGAGAGTTATATATCTAAAGGAACAAAGAATGAGGCCTACGAAATTATTAGC ATTGTATAAAAAAAAAAAGAAAAAAAAAAGAAAAAAAAAAAAGATTATATATATAAT ATATGTTGACAATTAATAAATATATTTGTATATATCTGTTAACTAATTATGAAAATTTTT GAATCAATAAATTTTTTAAATAACAAAAAAAAAAAAAAATATATATATTATATATATA TTTTATATTTTATATTTTCTTGTAATTTTTGTTTTTTTAGGAGGAAAAACATGCCCTAGA AAATggcggtggaTACCCTTACGATGTGCCTGATTACGCGTAtCCcTAtGAcGTaCCaGAcTAtG CGTACCCtTAtGAcGTtCCgGATTAtGCtcacggggtgTAAGCGGCCGCGGTCTTGTTCTTATTTT CTCAATAGGAAAAGAAGACGGGATTATTGCTTTACCTATAATTATAGCGCCCGAACTA AGCGCCCGGAAAAAGGCTTAGTTGACGAGGATGGAGGTTATCGAATTTTCGGCGGATG CCTCCCGGCTGAGTGTGCAGATCACAGCCGTAAGGATTTCTTCAAACCAAGGGGGTGA CTCCTTGAACAAAGAGAAATCACATGATCTTCCAAAAAACATGTAGGAGGGGACAACA ATTTGGTTTTGTTTTTTTCTTTAGGTTTTGAGAAAAACAAATAGGAAATACAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAATGTATTTTTACATATGCACTTGGATTA TTTTATTTTTATTATTTTTCTTTATATAAAGTAAAAATATACATAAGTATGCTTATTTATT ACATAAGAGTTTATTTAAGAAAGGTTTCTTTTTCATAATATTGTGTGCATGAGTTTTTTT TTATTTTATTTTTTTTTTTTATTTCTGTAACGAAAAGGATATTAAAAAAAATAATAAAA- 3’ (synthesized by GenScript Biotech [Piscataway, NJ, USA]). This homology repair construct comprises a 3 x Hemaglutinin (3HA ...
-
bioRxiv - Biochemistry 2020Quote: Disulfide mutants were designed using the Disulfide by Design 2 software69 and synthetic genes ordered from Genscript.
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 B.1.617 and B.1.1.7 variant Spikes were codon-optimized and synthesized by GenScript Inc (Nanjing ...
-
bioRxiv - Immunology 2020Quote: ... The SARS-CoV-2 S-2P ectodomain trimer (GenBank: YP_009724390.1, BEI NR-52420) was synthesized by GenScript into pCMV with an N-terminal mu-phosphatase signal peptide and a C-terminal TEV cleavage site (GSGRENLYPQG) ...
-
bioRxiv - Microbiology 2021Quote: The Bma-LAD-2-Renilla reniformis luciferase (Ruc) construct was inserted into a pREN2 vector by Genscript. The predicted signal sequence was removed prior to gene synthesis ...
-
bioRxiv - Biophysics 2022Quote: The full-length E-protein sequence from SARS-CoV-2 (GenBank Accession: NC_045512.2) was purchased from GenScript as a synthetic gene with optimized codon use for expression in Xenopus laevis ...
-
bioRxiv - Immunology 2022Quote: ... The SARS-CoV-2 S ‘2P’ ectodomain trimer (GenBank: YP_009724390.1, BEI NR-52420) was synthesized by GenScript into pCMV with an N-terminal mu-phosphatase signal peptide and a C-terminal TEV cleavage site (GSGRENLYPQG) ...
-
bioRxiv - Immunology 2022Quote: ... Human codon-optimized cDNA encoding SARS-CoV-2 spike glycoproteins of various strains were synthesized by GenScript and cloned into eukaryotic cell expression vector pcDNA 3.1 between the BamHI and XhoI sites ...
-
bioRxiv - Microbiology 2022Quote: ... Specific anti-CoV immunoreactivity was detected using SARS-CoV-2 nucleocapsid antibody (GenScript Biotech, Piscataway, NJ, USA) at a 1:1000 dilution ...
-
bioRxiv - Immunology 2023Quote: Lentiviral vectors for expression of SARS-CoV-2 spike (Delta variant B.1.617.2, NCBI accession # OX014251.1) were designed and synthesized from Genscript together with the two packaging plasmids (pMD2.G and psPAX2) ...
-
bioRxiv - Microbiology 2022Quote: ... Omicron BA 1.1 spike (from Dr. Raul Cachau, NIAID) or CoV-2 Spike RBD (His-Tag, Genscript) was diluted in phosphate buffered saline (PBS ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cDNA encoded the SARS-CoV-2 PLpro with mammalian codon optimization was also ordered from GenScript and cloned into the pcDNA 3.1 with an C-terminal FLAG tag ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The solubilized supernatant fraction was incubated with 2 mL anti-FLAG affinity resin (GenScript Biotech, Piscataway, NJ) and stirred at 4°C for 2 hrs ...
-
bioRxiv - Microbiology 2023Quote: ... A rabbit anti-SARS-CoV-2 neutralizing antibody (4G6) was purchased from Genscript (Cat. No. A02053-100). Rabbit monoclonal antibodies against 6-His-tags (12698S ...
-
bioRxiv - Immunology 2023Quote: ... NCBI accession # OX014251.1) and Sars-CoV-2 nucleocapsid (NCBI accession # OP359729.1) were designed and synthesized from Genscript together with the two packaging plasmids (pMD2.G and psPAX2) ...
-
bioRxiv - Genomics 2024Quote: ... 5% glycerol and 0.2% NP-40) and eluted with 2 mg/mL HA peptides (GenScript, no. RP11735). To prepare western blot sample from co-IP eluates ...
-
bioRxiv - Immunology 2024Quote: ... vaccines consisted of 5 µg SARS-CoV-2 Spike RBD WH-01 (RBD) protein (GenScript, cat# Z03483) or 5 µg ovalbumin (OVA ...
-
bioRxiv - Biophysics 2024Quote: The codon-optimized gene encoding the isoform 2 of full-length human HGSNAT was synthesized by GenScript. The synthesized gene was then cloned into the pEG BacMam expression vector (Addgene plasmid # 160683 ...
-
bioRxiv - Neuroscience 2021Quote: ... plko.1-CMV.Puro-tGFP-shFoxg1 or plko.1-CMV.Puro-tGFP-shLuciferase (Genscript) plasmids ...
-
bioRxiv - Microbiology 2022Quote: ... The samples were heated for 10 min at 100°C and were then loaded on an SDS gradient gel (4–20% Precast Protein Improve Gels, Genscript Biotech Corporation). The gel was run for 120 min at 120 V ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... the same amount of whole cell proteins extracted from a positive sample and a control sample were individually boiled with the gel-loading buffer (4×LDS, Genscript, Nanjing, China), and loaded onto a 4 – 12% gradient SDS-PAGE gel (Genscript ...
-
bioRxiv - Biochemistry 2024Quote: Codon optimized sequences of NAPstar3b and HyPer7 for expression in mammalian cells were commercially synthesized (Supplementary Table 4) (GenScript Biotech, Rijswijk, Netherlands) and delivered in pcDNA3.1(+ ...
-
bioRxiv - Plant Biology 2023Quote: ... Membranes were incubated with primary antibody for one hour (α-CLuc; Santa-Cruz Biotech) at room temperature or overnight at 4°C (α-His; GenScript), followed by washes with TBS-T ...
-
bioRxiv - Bioengineering 2023Quote: ... and KLF4 from a polycistronic transcript (TRE3-OSK) and second construct encoding rtTA version 4 driven by hEf1a promoter (hEf1a-rtTA4) were generated by Genscript (Piscataway, NJ) as reported previously (Lu et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... 1:100 (A00487, Genscript). All secondary antibodies were purchased from Invitrogen and used at 1:700 and were Alexa Fluor-488 Donkey anti-rabbit (A21206) ...
-
bioRxiv - Immunology 2022Quote: ... β-Actin (GenScript, 1:15,000), T-bet (clone 4B10 Santa Cruz ...
-
bioRxiv - Immunology 2022Quote: ... β-actin (GenScript, 1:15,000), goat anti-mouse (Jackson Immunoresearch ...
-
bioRxiv - Biophysics 2024Quote: ... named EKAR-1 (GenScript). To create entry vectors ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: The RBD-ACE2 assay was performed using SARS-CoV-2 sVNT ready to use kit sold by Genscript Inc ...
-
bioRxiv - Biochemistry 2021Quote: Full length SARS-CoV-2 nsp3 was codon optimized and cloned into a pcDNA-(+)-C-DYK vector (Genscript). Truncations were performed using primers listed in Table 1 ...
-
bioRxiv - Microbiology 2020Quote: ... Specific anti-CoV immunoreactivity was detected using an in-house SARS-CoV-2 nucleocapsid protein rabbit antibody (Genscript) at a 1:1000 dilution ...