Labshake search
Citations for GenScript :
451 - 500 of 587 citations for Mouse CSRNP1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... HeLa FJ-KO cells were transfected with the following plasmids: pMK204-TetOne AAVS1-MCS (+) Flag-tagged FANCJ WT or pMK240-TetOne AAVS1-MCS (+) Flag-tagged FANCJ-AALA (GenScript). The plasmid pMK240-TetOne AAVS1-MCS (+) ...
-
bioRxiv - Bioengineering 2019Quote: ... DNA sequences coding for HMG-box Pf and Hs were cloned into the plasmid pET-24c (+) (KanR) by GenScript (USA). The coding sequences of both domains were optimized for codon usage of the host (E ...
-
bioRxiv - Microbiology 2020Quote: ... stable GFP expression by GAS was created by synthesizing the ribosomal binding site (RBS) and gfp gene from pDCerm-GFP (Ly et al., 2014) into the pUC57 plasmid (GenScript), resulting in pUC57-RBSGFP plasmid ...
-
bioRxiv - Biophysics 2020Quote: The plasmid containing the catalytic domain of PKA (PKAc) was a gift from Susan Taylor via Addgene (#14921).13 The other plasmids were synthesized by Genscript and codon optimized for expression in E ...
-
bioRxiv - Biophysics 2020Quote: ... The plasmid encoding full-length human DAP5 with an N-terminal 6x-histidine tag was purchased from Genscript (Piscataway, NJ). All the proteins were recombinantly expressed in E ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... SARS CoV-2 Mpro and PLpro expression plasmids pcDNA3.1 SARS2 Mpro and pcDNA3.1 SARS2 PLpro was ordered from Genscript (Piscataway NJ) with codon optimization.
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... The latter plasmid was generated by placing the following de novo synthesized V5-GAL4v-VP48-OLLAS (GAL4-VP48) sequence (Genscript) into EcoRV-digested pUC57 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... pSensor09 was constructed by amplifying the backbone plasmid p416TEF1 using primer pair pYDA05/20 and primer pair pYDA21/22 to amplify PTEF1-YAS3-TCYC1 (Genscript_003).
-
bioRxiv - Neuroscience 2019Quote: ... ZsGreen sequences were removed from the plasmid (HRI-HA Tet-On minZsGreen) leaving only HRI and HA inserted (constructs synthesized by GenScript). Codon-optimized versions were made in HRI-HA Tet-On minZsGreen plasmids using GenScript algorithms including optimization of the HA tag ...
-
bioRxiv - Immunology 2020Quote: ... plasmid that contained predesigned guide RNA targeting Adar1 (5’-CTTGTCCGTCAAGTACCAGA-3’) and a pLentiCRISPR v2 plasmid that contained predesigned guide RNA targeting Adar2 (5’-AGTACCGCCTGAAGAAGCGA-3’) were obtained from GenScript. These plasmids were then transfected into Raw 264.7 cells using a Neon Transfection System (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2021Quote: ... following published Current Protocols in Neuroscience.43 Plasmids for SARS-CoV-2 variants were synthesized using the prototype sequence (GenScript MC_0101081 ...
-
bioRxiv - Immunology 2021Quote: ... were derived from the Wuhan-Hu-1 strain genome sequence (GenBank MN9089473) and synthesized and subcloned into a CMVR plasmid by Genscript. RBD with VOC point mutations were generated using a modified QuikChange site-directed mutagenesis protocol (Agilent) ...
-
bioRxiv - Immunology 2020Quote: The SARS-CoV-2 pseudovirus was produced by co-transfection of HEK293T cells with 1:1 ratio of DNA plasmid encoding SARS-CoV-2 S protein (GenScript) and backbone plasmid pNL4-3.Luc.R-E-(NIH AIDS Reagent ...
-
bioRxiv - Molecular Biology 2021Quote: ... plasmid (Addgene plasmid #48138)62 containing a guide RNA (5’-ACTGAGCTTGGATGCTTCTG-3’) and a donor plasmid containing 700 bp homology arms and a RPAC1 tag synthesised by GenScript into pUC57-Mini plasmid ...
-
bioRxiv - Genetics 2022Quote: ... integration cassettes were constructed by replacing a spt5+ gene fragment (+2398 of the spt5 ORF to the stop codon) in the pUC19-based spt5CTD+-ura4-spt53’ plasmid (75) with synthetic DNA fragments (Genscript) harboring the relevant mutations ...
-
bioRxiv - Microbiology 2022Quote: ... The plasmids were generated by synthesis of Flex-mCherry and Flex-eGFP and inserted into humanized M plasmids described in [7] using EZcloning from Genscript. The SARS-CoV-2 N protein was tagged at the N-terminus ...
-
bioRxiv - Microbiology 2022Quote: ... and ZIKV (GenBank accession no. NC012532, UniProt accession no. Q32ZE1) were commercially synthesized and cloned into plasmid pUC57 by GenScript Biotech ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNA was synthesized in pcc1-pbrick plasmid between cauliflower mosaic virus promoter (CaMV) 35S promoter and CaMV PolyA terminator de novo by GenScript, Piscataway ...
-
bioRxiv - Molecular Biology 2022Quote: ... and AALA mutant were produced as GST-fused proteins by cloning the encoding ORF sequences into the pGEX-6P-1 plasmid (GenScript).
-
bioRxiv - Synthetic Biology 2022Quote: ... The designed construct was gene synthesized and cloned into the pCDF plasmid backbone using the Ncol and XhoI restriction sites added by Genscript with an alanine codon added after the first methionine in the signal peptide to ensure in-frame with the Ncol restriction site.
-
bioRxiv - Microbiology 2023Quote: ... XG014 and DXP-604 were produced by transfection of HD CHO-S cells with plasmids in a 30-ml volume (GenScript). Monoclonal IgA1 antibodies were produced in CHO cells transiently transfected with two plasmids expressing a heavy and light chain ...
-
bioRxiv - Immunology 2023Quote: Antibody binding was also assayed by flow cytometry using CHO-K1 and CHO-K1 Fut8 KO cells transfected with a human PD-1 plasmid (GenScript) by lipofectamine (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Knockout of β2m was performed using the pLentiCRISPR v2 CRISPR/Cas9 system37 using a pLentiCRISPR v2 plasmid encoding the β2m-targeting guide RNA (gRNA): GAGTAGCGCGAGCACAGCTA (Genscript). Lentiviral particles were packaged in HEK293T cells (ATCC ...
-
bioRxiv - Neuroscience 2023Quote: ... the plasmid backbone was generated by EcoRI/HindIII restriction digestion of the K89/34 scFv originally generated to order by Genscript. These digestions were followed by heat inactivation of the enzymes by incubation at 80 °C for 20 min ...
-
bioRxiv - Neuroscience 2023Quote: ... The plasmid backbone was generated by EcoRI/HindIII restriction digestion of the N52A/42 scFv originally generated to order by Genscript. The second subset of scFvs were cloned into the pcDNA3.4 expression plasmid ...
-
bioRxiv - Biophysics 2023Quote: ... or one with the GCN4 peptide (EELLSKNYHLENEVARLKK) were synthesized and subcloned into the pcDNA3.1-mGL-NLuc plasmid using BamHI-XhoI sites (GenScript, Singapore). For generating the picLg and picLg-GCN4 fragment expressing plasmids ...
-
bioRxiv - Cell Biology 2023Quote: The full length of TgREMIND DNA sequence and those of its N-terminus F-BAR and C-terminus REMIND domains were synthesized and cloned into the pGEX plasmid by GenScript using the restriction enzymes BamHI and NcoI ...
-
bioRxiv - Plant Biology 2023Quote: ... The plasmids pGEX-4T-1_CepuHY2 and pGEX-4T-1_NediHY2 were purchased as already cloned by GenScript (Piscataway, New Jersey, USA). The full list of employed constructs can be found in Supplemental Materials (Table S2).
-
bioRxiv - Biochemistry 2023Quote: ... T4-foldon trimerisation domain and ADAH11 spaced by glycine-serine linker sequences (Supplementary Table 6) was inserted into the pHEN6 plasmid (Genscript), expressed in T7 Express E ...
-
bioRxiv - Biophysics 2023Quote: ... nucleotide sequences encoding picALuc residues G23-C120 or with the GCN4 peptide were synthesized and subcloned into pcDNA3.1-mGL-NLuc plasmid using the HindIII-XhoI sites (GenScript, Singapore).
-
bioRxiv - Synthetic Biology 2024Quote: ... the T7 RNAPC (110-883 aa of T7 RNAP), and ZA/ZB fragments were synthesized and cloned into the plasmid pJM1B6 (Yuan, 2022) by GenScript Biotechnology (Nanjing ...
-
bioRxiv - Immunology 2024Quote: ... T2A sequence and an anti-CD19 single-chain variable fragment (scFv) fused to 4-1BB and CD3ζ stimulatory endodomains (for TRAC-CAR19-KI) were subcloned into recombinant AAV6 plasmids (GenScript). DNA sequences were flanked with 400 base-pair homology arms immediately upstream and downstream of the TET2 gRNA or TRAC gRNA cut sites ...
-
bioRxiv - Molecular Biology 2023Quote: A DNA library (Supplementary Table 6, 7) comprising seven random nucleotides was created and subsequently cloned into the plasmid pUC18 by GenScript. This random library was transformed in XL1blue E ...
-
bioRxiv - Molecular Biology 2023Quote: ... The pBY011 plasmid encoding yeast CHD1 gene under the GAL1/10 promoter was obtained from a DNASU plasmid repository and altered by GenScript, where FLAG tag and NES-NES sequences were added to the N- and C-termini of the gene ...
-
bioRxiv - Biochemistry 2023Quote: Human Mint1 sequences for bacterial expression were codon optimised and sub-cloned into the pGEX4T-2 plasmid by Genscript (USA). The constructs generated were GST-tagged Mint1(226- 314)(MID) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... cells were transiently transfected with plasmids containing receptors of interest under eukaryotic expression promoters (ASGR1 was clone OHU03658D from GenScript), then split into 96-well plates (20,000 cells per well ...
-
bioRxiv - Genetics 2023Quote: All assembly parts (consisting of fragments F1 to F12 designed in the previous protocol with appended Type IIS cut sites) were ordered as plasmids in a pUC57-mini BsaI-Free backbone from Genscript at a maxiprep scale (Supplementary Table 2) ...
-
bioRxiv - Molecular Biology 2024Quote: ... HA) (E1), HPV16 E2, pGL3 Basic, pGL3 Control, ptk6E2 (22, 68, 69) E2-K mutant plasmids were generated by GenScript.
-
bioRxiv - Microbiology 2024Quote: ... lentiviruses were generated in HEK293T cells by transfection of pLentiCRISPRv2 -Puro plasmid containing a single guide RNA (sgRNA) (GTACTGTAGATGGTGCTCAT) (GenScript) targeting ACE2 ...
-
bioRxiv - Neuroscience 2024Quote: ... New constructs were commercially synthesized and subcloned into either the pCA LNL or pCig2 plasmid backbones by GenScript (Piscataway, NJ). Subsequent exchange of expression vectors between pCig2 and pCA LNL and other subcloning were performed in house using standard procedures ...
-
bioRxiv - Cancer Biology 2024Quote: ... which were kindly provided by Professor Yu Zhang at National Institute of Biological Sciences as gifts (the sgPTPRN2 plasmid was further cloned by GenScript), were simultaneously transfected with Lipo3000 transfection reagent (ThermoFisher Scientific) ...
-
bioRxiv - Biochemistry 2024Quote: ... fused to consecutive C-terminal HA (hemagglutinin)- and FLAG-tags and cloned into pCDNA-3.1 plasmid for expression in HEK293 cells by the CMV (cytomegalovirus) promoter (GenScript Biotech). Mutant variants were generated by site directed mutagenesis (GenScript Biotech).
-
bioRxiv - Immunology 2024Quote: ... 293F cells were transfected with plasmids containing Spike protein (ATUM plasmid pD2528-CMV with insert QHD43416.1) and Spike-2P protein (site-directed mutagenesis to generate the 2P mutation on the plasmid containing Spike protein, GenScript) by 293fectinTM transfection reagent (Gibco ...
-
bioRxiv - Biophysics 2024Quote: ... A pET28a(+) plasmid containing an open reading frame for human hnRNPA1 with an N-terminal 6xHis tag was synthesized by GenScript. The 6xHis-hnRNPA1 was expressed in E ...
-
bioRxiv - Microbiology 2021Quote: ... Western blot using a mouse anti-Histidine tag monoclonal Antibody (Genscript Cat. No. A00186) was used to confirm purity of the purified protein (Figure-1S) ...
-
bioRxiv - Microbiology 2022Quote: ... which were coated in anti-HIS antibody [Biotin] (GenScript A00613, mouse IgG1k clone 6G2A9) at 2.5 μg/mL ...
-
bioRxiv - Biophysics 2022Quote: ... Biotin-labeled mouse monoclonal antibody against the Strep-tagII (“NWSHPQFEK”) was purchased from Genscript (GenScript Cat# A01737 ...
-
bioRxiv - Biochemistry 2020Quote: A custom-made mouse monoclonal antibody against the isoDGR motif was prepared by GenScript Corporation (Piscataway ...
-
bioRxiv - Cell Biology 2020Quote: To generate pLenti-mTomm70A-EGFP the open reading frame of mouse Tomm70A (GenScript OMu13526) was amplified via PCR and inserted into pcDNA-EGFP introducing a ten amino acid long linker between mTomm70A and EGFP (GGSGDPPVAT) ...
-
bioRxiv - Cell Biology 2020Quote: ... To generate pLenti-mTimm50-mRFP the open reading frame of mouse Timm50 (GenScript OMu13400) was amplified via PCR and inserted into pcDNA-mRFP introducing a ten amino acid long linker between mTimm50 and mRFP (GGSGDPPVAT) ...