Labshake search
Citations for GenScript :
451 - 500 of 1264 citations for Fumarase from porcine heart since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... and FAM-labeled StpA2-17 were purchased from GenScript Japan (Tokyo ...
-
bioRxiv - Biophysics 2023Quote: ... LRRC55 (γ3) and LRRC38 (γ4) were obtained from Genscript and used to generate expression constructs as described above for γ1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The human XIST oligo pool was ordered from GenScript and amplified as previously described to generate ssDNA biotinylated oligos (Engreitz et al. ...
-
bioRxiv - Immunology 2023Quote: ... DNA sequences encoding the genes were purchased from GenScript, amplified by polymerase chain reaction (PCR) ...
-
bioRxiv - Genomics 2023Quote: ... plasmids containing wild type ORFs were obtained from GenScript. The ORFs were cloned into the pcDNA3.1(- ...
-
bioRxiv - Biochemistry 2023Quote: ... The plasmid of tetraubiquitin (Ub4) was ordered from GenScript. This plasmid contains the ubiquitin gene repeated four times and contains a N-term GST tag as well as a 3C HRV cleavage site.
-
bioRxiv - Biochemistry 2023Quote: ... All peptides were purchased from GenScript (Piscataway, NJ, USA) with C-terminal amidation and more than 98% purity ...
-
bioRxiv - Cell Biology 2023Quote: ... mito-TLNRD1-mScarlet-I constructs were purchased from GenScript. Briefly ...
-
bioRxiv - Biochemistry 2024Quote: ... All plasmids were purchased from GenScript (Piscataway, NJ, USA) based on the pET-28a(+ ...
-
bioRxiv - Biochemistry 2024Quote: ... coli-optimized codons (purchased from Genscript, Piscataway, New Jersey). The wild-type and 15N-labelled protein was purified using heat treatment ...
-
bioRxiv - Microbiology 2024Quote: ... A rabbit IgG anti-Avi polyclonal antibody from Genscript was used at a dilution of 1:3000 in combination with a goat anti-Rabbit IgG-HRP monoclonal antibody at 1:2000 ...
-
bioRxiv - Cell Biology 2024Quote: ... the TMEM165 cDNA was amplified from pCDNA3.1NEGFP-TMEM165 (Genscript) and inserted into pLentiCMVie-mCherry-BlastR via NheI and XhoI sites ...
-
bioRxiv - Bioengineering 2024Quote: Crosslinker and adhesion ligand sequences were purchased from GenScript as outlined in Table 1 ...
-
bioRxiv - Microbiology 2024Quote: ... sapiens FKBP12 constructs were obtained from GenScript (Piscataway, NJ) in the pET-15b vector ...
-
bioRxiv - Immunology 2024Quote: ... Lentiviral plasmids expressing sgRNA were either purchased from Genscript or generated in-house using oligonucleotides synthesized by Integrated DNA Technologies (IDT).
-
bioRxiv - Molecular Biology 2024Quote: ... Oligonucleotide pools encoding docking peptides were ordered from GenScript and were amplified by PCR (10 cycles ...
-
bioRxiv - Cancer Biology 2024Quote: ... and TEAD1-NCOA2 (generated by and purchased from Genscript, Piscataway ...
-
bioRxiv - Microbiology 2024Quote: ... Human STAT1 and IRF1 sgRNAs were purchased from GenScript. Two independent sgRNAs were used to generate CRISPR KO cell lines with the lentiviral system.
-
bioRxiv - Bioengineering 2024Quote: Genes encoding the selected designs were synthesized from GenScript, cloned onto pET-29b(+ ...
-
Protein identification using cryo-EM and artificial intelligence guides improved sample purificationbioRxiv - Biochemistry 2024Quote: ... C-terminal histidine-tagged plasmids were ordered from GenScript and transformed into E ...
-
bioRxiv - Cancer Biology 2024Quote: POU3F2-Human_pcDNA3.1(+)-P2A-eGFP plasmid was created from GenScript. Bacteria containing the plasmid from agar stabs were streaked onto LB agar petri dishes with 100 μg/mL ampicillin and grown at 30°C for 24 hours ...
-
bioRxiv - Cancer Biology 2024Quote: ... and pcDNA3.1(+) (empty vector control) were purchased from GenScript. UBA1ms cDNA ORF clone including the 135 extra bases was generated and subcloned into UBA1_OHu24932D_pcDNA3.1+/C-(K)-DYK using GenScript gene synthesis and subcloning service.
-
bioRxiv - Biophysics 2020Quote: ... Lysine-Cysteine-Lysine-Deca-histidine peptide was purchased from GenScript. Purified mouse CD45RABC extracellular domain with a C-terminal 6-His tag (accession # ...
-
bioRxiv - Cell Biology 2020Quote: ... Purified GST peptide was purchased from Genscript (catalog number 202039). Purified GST-tagged LC3 protein was purchased from Ubiquigent (catalog number 60-0111-500) ...
-
bioRxiv - Molecular Biology 2022Quote: ... a synthetic gene encoding Pae87 (pae87) was obtained from GenScript, and cloned into a pET28a(+ ...
-
bioRxiv - Immunology 2022Quote: ... the peptides were ordered from Genscript (TFA removal, >85% purity) and dissolved in a base buffer consisting of 50 mM NaCl ...
-
bioRxiv - Biophysics 2022Quote: ... M0 mimicking peptide was purchased from GenScript (Piscataway, NJ, USA).
-
bioRxiv - Bioengineering 2021Quote: ... All peptides used in this study were purchased from GenScript USA ...
-
bioRxiv - Cell Biology 2020Quote: ... Polyacrylamide gel (SurePAGE™, 4-20%) was bought from Genscript Biosciences (Nanjing ...
-
bioRxiv - Microbiology 2021Quote: ... Polyclonal antibodies against OVA or SV40 were obtained from GenScript (GenScript ...
-
bioRxiv - Plant Biology 2021Quote: ... Synthetic CLE peptides were obtained from a commercial supplier (Genscript) at > 80% purity ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA of Add3 was purchased from Genecript (GenScript Bioteh, NJ). The ORF was subcloned into the same vector as that of the αMHC-Add1i2 ...
-
bioRxiv - Microbiology 2022Quote: ... HA or flag-tagged nsp5,7,8,12 constructs (synthesized from Genscript. Inc.) in a 12-well plate ...
-
bioRxiv - Plant Biology 2022Quote: ... all synthetic gene constructs were obtained from Genscript (Piscataway, USA). The DNA sequences coding for AvrLm5-9 ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNA sequences encoding XKR3 and XKR6 were purchased from Genscript and Origene ...
-
bioRxiv - Molecular Biology 2020Quote: ... MIR200 CRISPR V2 was custom-made and purchased from Genscript (sequence of the gRNA is TGGGAGTCTCTAATACTGCC) ...
-
bioRxiv - Pathology 2021Quote: PRR4 cDNA was obtained from ORF clone plasmid (OHu15631, GenScript). PRR4 cDNA without a signal peptide sequence (corresponding to amino acids 17 to 134 ...
-
bioRxiv - Molecular Biology 2022Quote: 60 Human ORF clones were purchased from GenScript (https://www.genscript.com) for the Wnt pathway (Table S1) ...
-
bioRxiv - Microbiology 2022Quote: pPB-cytBirA was obtained from a synthetic DNA fragment (Genscript) containing the BirA enzyme open reading frame of Escherichia coli (UniProt accession number ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the fxpk gene from Bifidobacterium adolescentis9,12 was synthesized (Genscript, USA) with codon-optimization for C ...
-
bioRxiv - Bioengineering 2020Quote: ... mNG-NL and SUMO-TNFα-SB were ordered from GenScript. The sequence of mNG-NL was reported by Suzuki et al32 ...
-
bioRxiv - Systems Biology 2020Quote: ... The codon-optimized kmERG1 were ordered from GenScript (Table S1), and the PrimerSTAR HS polymerase was utilized for gene amplification through PCR ...
-
bioRxiv - Microbiology 2020Quote: ... coli situated in pET28b were purchased from Genscript (Piscataway, NJ). Sequence data for these constructs are provided as supplemental data ...
-
bioRxiv - Immunology 2020Quote: For the surrogate neutralization assay the cPass kit from GenScript was used (Cat ...
-
bioRxiv - Biophysics 2021Quote: ... Single-chain MspA genes were ordered from GenScript (Piscataway, NJ). Description of construction of single-chain MspA M2 and single-chain MspA PN1 plasmids are in the SI Appendix.
-
bioRxiv - Neuroscience 2021Quote: ... DYKDDDDK (Flag)-tagged human FAM57B plasmid was purchased from Genscript. Hemagglutinin (HA)-tagged human CerS plasmids were generated as described76.
-
bioRxiv - Immunology 2021Quote: ... and a peptide derived from TM87B were manufactured by Genscript.
-
bioRxiv - Immunology 2020Quote: ... mCherry-IiR4R6P/L17A was purchased from GenScript (Piscataway, NJ, USA). HLA-A2-GFP has been described and transfections were carried out as already described 20 ...
-
bioRxiv - Genetics 2021Quote: ... HDR templates were ordered in dsDNA form (plasmids) from GenScript or Genewiz ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: The plasmid pcDNA3 encoding ACE2 was obtained from GenScript (OHu20260); the plasmid encoding prolactin (PRL ...