Labshake search
Citations for GenScript :
451 - 500 of 842 citations for Cow Four And A Half LIM Domains Protein 2 FHL2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: Our RAD-51 antibody was generated from a His-tagged fusion protein expressed by Genscript from plasmid pET30a containing the entire RAD-51S coding sequence (1385 bp ...
-
bioRxiv - Biochemistry 2021Quote: ... 15 μg total protein was loaded and resolved on Bis-Tris 4-12% gels (GenScript) and transferred to a polyvinylidene difluoride (PVDF ...
-
bioRxiv - Microbiology 2021Quote: Microtiter plates (96-well; Thermo) were coated with 1 μg/mL S-2P protein (Genscript) corresponding to the S protein of the Wuhan-Hu-1 virus ...
-
bioRxiv - Molecular Biology 2021Quote: ... the supernatant containing the target proteins was loaded onto anti-FLAG G1 affinity resin (Genscript). The resin was washed using buffer A (20 mM Tris ...
-
bioRxiv - Microbiology 2021Quote: LAD2 cells (3×105) were incubated with Spike-RBD protein (5 μg/mL, Genscript, Z03483) in adherent buffer (1mM CaCl2 ...
-
Bacterial killing by complement requires direct anchoring of Membrane Attack Complex precursor C5b-7bioRxiv - Immunology 2019Quote: ... 50 µM of LPETG-His tagged protein was incubated with 1 mM GGG-azide (Genscript) and 25 µM His-tagged sortase-A7+ (recombinantly expressed in E ...
-
bioRxiv - Immunology 2021Quote: ... The lysate was immunoprecipitated using designated primary antibodies with protein G resin (GenScript, Piscataway, NJ), or anti-Flag M2 affinity agarose gel at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... The SECphi4 56aa protein of unknown function was the only gene not synthesized by Genscript Corp ...
-
bioRxiv - Plant Biology 2022Quote: ... samples were run on a 4%-20% gradient protein gels (GenScript, SurePAGE, Cat. No. M00655) and stained with Fast Silver Stain Kit (Beyotime ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmids expressing the PABPN1- Flag (NM_004643) and THOC5-HA (NM_001002878.1) proteins were purchased from GenScript. Plasmid pcDNA-THOC1-HA was generated by cloning the THOC1 sequence from plasmid phHpr1-GST (Addgene #11200 ...
-
bioRxiv - Molecular Biology 2023Quote: ... whereas all other gels were stained using the eStain™ L1 protein staining system (GenScript). Precision Plus Protein™ standards (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2023Quote: ... Equal amounts of protein lysates were loaded onto SurePAGE Bis-Tris 4-20% gels (Genscript) and transferred either to
-
bioRxiv - Microbiology 2023Quote: ... or 9 ug/mL of full-length FimH protein (antigen for custom antibody production, Genscript) was used.
-
bioRxiv - Genetics 2023Quote: ... The protein samples were separated by SDS-PAGE (4-12% Bis-Tris gels, Genscript, #M41210C) with MOPS buffer (Tris-MOPS-SDS Running Buffer ...
-
bioRxiv - Cancer Biology 2023Quote: ... Protein coding sequences for PRMT1v1 (ENST00000391851.8) and PRMT1v2 (ENST00000454376.7) were ordered from GenScript (https://www.genscript.com) and PCR-cloned into pHIV-Luc-ZsGreen (Addgene plasmid #39196 ...
-
bioRxiv - Microbiology 2023Quote: ... the purified polyclonal antibodies against RNase E was bound to Protein A/G MagBeads (Genscript), followed by cross-linking using dimethyl pimelidate dihydrochloride (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2023Quote: ... Sup35NM was visualized using an antibody raised against residue 125-253 of the protein(GenScript). Cell lysates were fractionated by SDS-PAGE ...
-
bioRxiv - Microbiology 2023Quote: ... enterica Tsr LBD construct for recombinant protein expression was performed as a service by Genscript Biotech Corp ...
-
bioRxiv - Cancer Biology 2024Quote: ... The expression of the CAR was detected using a biotinylated protein L (GenScript, Piscataway, NJ) antibody and streptavidin-coupled PE (BD Biosciences ...
-
bioRxiv - Bioengineering 2024Quote: PEG hydrogels were functionalized with the following peptides and proteins purchased from Genscript (Piscataway, NJ): RGDS ...
-
bioRxiv - Immunology 2021Quote: ... ToxinSensor™ Single Test Kit (GenScript) was applied to verify that the endotoxin levels of the nanoparticle sample were below 50 EU/kg per dose.
-
bioRxiv - Neuroscience 2021Quote: ... using a GenBuilder cloning kit (GenScript). pCS2HA-NPHP1 and pCS2HA-NPHP1 Δ(49-110 ...
-
bioRxiv - Molecular Biology 2024Quote: ... using a GenBuilder Cloning kit (GenScript). Reporter loxP-2272 was generated by substituting the lox17:N site (ATAACTTCGTATAGTATACCTTATAGCAATTTAT ...
-
bioRxiv - Immunology 2021Quote: ... Specific anti-CoV immunoreactivity was detected using a SARS-CoV-2 nucleoprotein antibody (Genscript) at a 1:1000 dilution ...
-
bioRxiv - Immunology 2021Quote: ... Enriched B cells were stained with Flag tagged SARS-CoV-2 spike (Genscript, Z03481) then incubated with APC conjugated anti-Flag and PE conjugated anti-Flag for double staining ...
-
bioRxiv - Systems Biology 2021Quote: ... cell were stained overnight at 4°C with SARS-CoV-2 N-antibody (Genscript) at a dilution of 1:500 in PBS + 1% BSA+ 1%FBS ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were stimulated with synthetic SARS-CoV-2 S peptides pool (Genscript, Cat# RP30020) at the concentration of 2 μg/mL for 12 h and then incubated with 5 μg/mL Brefeldin A (MCE ...
-
bioRxiv - Biochemistry 2022Quote: ... YedK peptide consisting of the amino acids 2-16 (CGRFAQSQTREDYLA) was synthesized by Genscript. 50 nM 5’-FAM-labeled AP-DNA (FAM_U_20 ...
-
bioRxiv - Microbiology 2020Quote: ... (2) the mScarlet gene (amplified from a P. falciparum codon-adjusted synthetic sequence (Genscript) (Fig ...
-
bioRxiv - Microbiology 2020Quote: ... SARS-CoV and SARS-CoV-2 (GenBank accession number NC_045512.2) were synthesized by GenScript Corporation (GenScript ...
-
bioRxiv - Immunology 2022Quote: ... the standard curve was run using an IgG1 SARS-CoV-2 neutralizing antibody (GenScript) for full quantification ...
-
bioRxiv - Immunology 2020Quote: ... human recombinant IL-2 (10 U/well) and with or without SIINFEKL peptide (Genscript) at 0.2ug/ml ...
-
bioRxiv - Biophysics 2022Quote: Full-length human 2’-5’-oligoadenylate synthase 1 (OAS1) has been purchased from Genscript and cloned in the pRSF-Duet1 vector ...
-
bioRxiv - Biochemistry 2023Quote: DNA encoding PEDV and SARS-CoV-2 nsps were codon optimized and synthesized (Genscript). PEDV protein sequences correspond to GenBank AKJ21892.1 ...
-
bioRxiv - Biochemistry 2022Quote: ... and were cultured in the presence of 10 ng/mL IL-2 (Genscript #Z00368), and the presence or absence of TNFα (100 ng/mL ...
-
bioRxiv - Biochemistry 2021Quote: ... Samples were next incubated under constant agitation with 10% (v/v) Protein-A-Sepharose beads (Genscript) for a further 2 h at 4°C before recovery by centrifugation at 13,000 g for 1 min ...
-
bioRxiv - Microbiology 2021Quote: Plasmids encoding cDNA for hMPV 130-BV F and hMPV B2 F proteins were synthesized (GenScript) and cloned into the pcDNA3.1+ vector as previously described (29 ...
-
bioRxiv - Cell Biology 2020Quote: Proteins were separated by SDS-PAGE on 4%-20% MOPS-acrylamide gels (GenScript Express Plus, M42012) and electrophoretically transferred onto Immobilon PVDF membranes (Fisher ...
-
bioRxiv - Bioengineering 2022Quote: ... The experiments were performed by direct immobilization of the recombinant IL6 protein (Cat. No. Z03034, Genscript), on a CM5 biosensor chip surface (Cytiva ...
-
bioRxiv - Biophysics 2022Quote: Genes encoding all NS1 EDs and p85β proteins were prepared by gene-synthesis service from Genscript: 1918 NS1 (residues 80 to 205) ...
-
bioRxiv - Immunology 2020Quote: ... cell culture media were clarified by centrifugation and the IgG captured using Protein G resin (Genscript). IgG were eluted from the resin using 100 mM glycine pH 3.0 ...
-
Sterilizing immunity against SARS-CoV-2 in hamsters conferred by a novel recombinant subunit vaccinebioRxiv - Microbiology 2020Quote: ... Coomassie brilliant blue staining for SDS-PAGE were performed using eStain L1 Protein Staining machine (Genscript). Gels for western blot were transferred onto the nitrocellulose membrane and reacted with COVID-19-convalescent serum (1:500 diluted) ...
-
bioRxiv - Neuroscience 2020Quote: ... and equal amounts of protein were separated on a 4-12% SDS-gel (Genscript SurePAGE™). Proteins were transferred onto a PVDF Immobilon-P (0.45 µm Millipore) ...
-
bioRxiv - Neuroscience 2021Quote: ... and a FLAG-HA tag in-frame with the sORF protein sequence was synthesized by Genscript and cloned into an FUGW overexpression vector (Addgene #14883) ...
-
bioRxiv - Cancer Biology 2021Quote: ... protein – NP_001058.2) cloned into pcDNA3.1+/C-(K)-DYK vector (Clone ID OHu21029D) was purchased from Genscript. The cDNAs were cloned into a bacterial expression vector ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The Hdp1opt and Hdp1opt L27Q proteins used for the in vitro experiments were synthesized by GenScript and resuspended in water for a stock concentration of 1 mg/ml.
-
bioRxiv - Immunology 2020Quote: Templates for the expression of proteins UF1 to UF6 were prepared by gene synthesis (GenScript, USA). Before synthesis ...
-
bioRxiv - Biochemistry 2021Quote: ... Seven µg of total protein were loaded on an SDS-PAGE gel (GenScript, New Jersey, USA), and then transferred to a PVDF membrane as previously described [42] ...
-
bioRxiv - Biochemistry 2021Quote: ... The wild-type protein and the mutant K96A cloned in pET28a vector were ordered from GenScript. The N-terminally truncated constructs were cloned by amplifying the sequence from the original vector and subcloning into BsaI-cleaved plasmid pNIC28_Bsa4 by SLiCE cloning (83) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The supernatants were incubated with 30 µl of protein A/G-coated magnetic beads (Genscript L00277) to remove the nonspecifically bound proteins for 1 hour at 4 °C with agitation ...