Labshake search
Citations for GenScript :
451 - 500 of 692 citations for 6H Dibenzo a g quinolizinium 5 8 13 13a tetrahydro 2 9 dihydroxy 3 10 dimethoxy 7 methyl 7S 13aS since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... M2 ORF of Ca/04 and 83 nucleotides of the 3’ end of the PB1 gene (40 nucleotides encoding the C-terminus of PB1 ORF and 43 from the 3’UTR region) was synthesized by Genscript (Piscataway, NJ). The fragments were digested with BsmBI ...
-
bioRxiv - Cell Biology 2020Quote: ... The cultures were then synchronized at G1 using 10 μg/ml α-factor (GenScript) for 2-3 hours ...
-
bioRxiv - Immunology 2019Quote: ... was added to wells either alone or with CGRP (1, 10, 100 nM, GenScript) and incubated for 72 hr ...
-
bioRxiv - Immunology 2021Quote: ... Media supplemented with 10 ng/mL of recombinant human VEGF (GenScript, Piscataway, NJ, U.S.) was used as a positive control ...
-
bioRxiv - Immunology 2023Quote: ... were coated with 1 μg/mL (for IgG) or 5 μg/mL (for IgA) S-2P protein (GenScript), corresponding to the spike protein of the Wuhan-Hu-1 virus stabilized with 2 proline mutations ...
-
bioRxiv - Molecular Biology 2024Quote: 5 µM STAT3136–705 (purified as described in 6) was incubated with 25µM phosphopeptides (Genscript, Piscataway, New Jersey) from the binding sites of gp130 (SGpYRHQVPSV) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: The above assay was performed using SARS-CoV-2 sVNT ready to use kit by Genscript, which is a competition ELISA ...
-
bioRxiv - Immunology 2021Quote: ... chimeric group 1 or group 2 stalk proteins expressed in Sf9 cells were column purified (GenScript). For functional assays and luminex Fc receptor binding and titer ...
-
bioRxiv - Immunology 2022Quote: ... The gene to express SARS-CoV-2 S2 PentaPro in prefusion conformation was synthetized by GenScript residues 686 to 1211 fused C-terminally to a foldon trimerization domain and His-tagged ...
-
bioRxiv - Microbiology 2020Quote: ... 60 or 100 nM of his/FLAG-tagged SARS-CoV-2 spike protein (GenScript, Z03481-100) was added to each well ...
-
bioRxiv - Immunology 2020Quote: ... The SARS-CoV-2 Spike gene from plasmid pUC57-2019-nCoV-S-Hu (GenScript, Piscataway, USA) was truncated in its cytoplasmic tail of 19 amino acids ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: The above assay was performed using SARS-CoV-2 sVNT ready to use kit by Genscript, which is a competition ELISA ...
-
bioRxiv - Immunology 2021Quote: ... The SARS-CoV-2 spike protein (ECD) and RBD were purchased from GenScript (Piscataway, NJ, USA).
-
bioRxiv - Cell Biology 2023Quote: ... rabbit anti-Akr1B-2 at 1:100,000 (produced to full-length Drosophila p23 (Q9VH95) by GenScript) and mouse anti-α-Tubulin at 1:5000 (AB_477593 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: The above assay was performed using SARS-CoV-2 sVNT ready to use kit by Genscript, which is a competition ELISA (4) ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatant was applied onto a self-packaged Ni-affinity column (2 mL Ni-NTA, Genscript) and contaminant proteins were removed with wash buffer (50 mM Tris pH 8.0 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Control (#2) and p53 gRNA (#4) vectors targeting human TP53 (GenScript, pLentiCRISPR v2, Piscataway, NJ, USA) were used to homozygously delete the TP53 gene in H1975 cells as per manufacturer instructions.
-
bioRxiv - Immunology 2024Quote: ... – BMDC of Pink1−/− mice were stained with Tag-it Violet as described previously and then coated on ice for 3 hours with the mitochondrial peptide pool (custom synthesis by Genscript or Canada Peptide) or mock pool (OVA 257-264 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Pre-cleared chromatin was incubated with 10 μg of anti-Sir3 polyclonal IgG antibody (Genscript) or anti-Rap1 polyclonal IgG antibody (Abcam ...
-
bioRxiv - Molecular Biology 2019Quote: ... Cells were arrested in G1 by addition of 10 µg/ml alpha factor peptide (Genscript) for 1.5 hrs ...
-
bioRxiv - Developmental Biology 2020Quote: ... RNA probes (Table S1) were synthesized and labeled with 6-FAM at the 5’ end by GenScript (Nanjing, China). For the RNA electrophoresis mobility shift assays (REMSAs) ...
-
bioRxiv - Microbiology 2020Quote: ... Membranes were blocked with 5% milk in PBS+0.1%Tween-20 and probed with anti-EnvP sera or mouse anti-GAPDH antibody (Genscript), followed by goat anti-mouse HRP (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... the PVDF membrane was blocked by 5% skim milk in TBST and incubated with HRP-conjugated streptavidin (GenScript, M00091) for the enhanced chemiluminescence detection ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were treated with 5 μM of recombinant (PR)20 peptides (with a C-terminal HA epitope tag, Genscript) for 10 days ...
-
bioRxiv - Immunology 2022Quote: ... KIR-CD3ζ JNL cells were also incubated with parental 721.221 cells as negative control and with anti-Flag-tag (5 µg/ml) (clone 5A8E5, GenScript) and goat anti-mouse (10 µg/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... Primary antibodies were dissolved in 5% BSA (Biofroxx, 4240GR005) and the dilutions were: Streptavidin-HRP (1:2000, GenScript, M00091), RL2 (1:1000 ...
-
bioRxiv - Cell Biology 2024Quote: ... α-factor was added to the cells to a final concentration of 5 ng/ml α-factor (GenScript RP01002) for 3 hours ...
-
bioRxiv - Microbiology 2023Quote: ... A full length TgLaforin cDNA containing its endogenous 5’UTR (2000 bp upstream from gDNA) was synthesized by GenScript and inserted into a pHA3x-LIC vector (Table S2 ...
-
bioRxiv - Immunology 2023Quote: ... 5×105 cells per well (6 well plate) were stimulated with 100 ng/mL of IFN-γ (Z02916, Genscript) for 0 h ...
-
bioRxiv - Molecular Biology 2022Quote: ... The pL7-PfSMC3-3HA-glmS plasmid also contained the homology repair construct 5’- AGATAGAGAGAGTTATATATCTAAAGGAACAAAGAATGAGGCCTACGAAATTATTAGC ATTGTATAAAAAAAAAAAGAAAAAAAAAAGAAAAAAAAAAAAGATTATATATATAAT ATATGTTGACAATTAATAAATATATTTGTATATATCTGTTAACTAATTATGAAAATTTTT GAATCAATAAATTTTTTAAATAACAAAAAAAAAAAAAAATATATATATTATATATATA TTTTATATTTTATATTTTCTTGTAATTTTTGTTTTTTTAGGAGGAAAAACATGCCCTAGA AAATggcggtggaTACCCTTACGATGTGCCTGATTACGCGTAtCCcTAtGAcGTaCCaGAcTAtG CGTACCCtTAtGAcGTtCCgGATTAtGCtcacggggtgTAAGCGGCCGCGGTCTTGTTCTTATTTT CTCAATAGGAAAAGAAGACGGGATTATTGCTTTACCTATAATTATAGCGCCCGAACTA AGCGCCCGGAAAAAGGCTTAGTTGACGAGGATGGAGGTTATCGAATTTTCGGCGGATG CCTCCCGGCTGAGTGTGCAGATCACAGCCGTAAGGATTTCTTCAAACCAAGGGGGTGA CTCCTTGAACAAAGAGAAATCACATGATCTTCCAAAAAACATGTAGGAGGGGACAACA ATTTGGTTTTGTTTTTTTCTTTAGGTTTTGAGAAAAACAAATAGGAAATACAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAATGTATTTTTACATATGCACTTGGATTA TTTTATTTTTATTATTTTTCTTTATATAAAGTAAAAATATACATAAGTATGCTTATTTATT ACATAAGAGTTTATTTAAGAAAGGTTTCTTTTTCATAATATTGTGTGCATGAGTTTTTTT TTATTTTATTTTTTTTTTTTATTTCTGTAACGAAAAGGATATTAAAAAAAATAATAAAA- 3’ (synthesized by GenScript Biotech [Piscataway, NJ, USA]). This homology repair construct comprises a 3 x Hemaglutinin (3HA ...
-
bioRxiv - Biochemistry 2020Quote: Disulfide mutants were designed using the Disulfide by Design 2 software69 and synthetic genes ordered from Genscript.
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 B.1.617 and B.1.1.7 variant Spikes were codon-optimized and synthesized by GenScript Inc (Nanjing ...
-
bioRxiv - Immunology 2020Quote: ... The SARS-CoV-2 S-2P ectodomain trimer (GenBank: YP_009724390.1, BEI NR-52420) was synthesized by GenScript into pCMV with an N-terminal mu-phosphatase signal peptide and a C-terminal TEV cleavage site (GSGRENLYPQG) ...
-
bioRxiv - Microbiology 2021Quote: The Bma-LAD-2-Renilla reniformis luciferase (Ruc) construct was inserted into a pREN2 vector by Genscript. The predicted signal sequence was removed prior to gene synthesis ...
-
bioRxiv - Biophysics 2022Quote: The full-length E-protein sequence from SARS-CoV-2 (GenBank Accession: NC_045512.2) was purchased from GenScript as a synthetic gene with optimized codon use for expression in Xenopus laevis ...
-
bioRxiv - Immunology 2022Quote: ... The SARS-CoV-2 S ‘2P’ ectodomain trimer (GenBank: YP_009724390.1, BEI NR-52420) was synthesized by GenScript into pCMV with an N-terminal mu-phosphatase signal peptide and a C-terminal TEV cleavage site (GSGRENLYPQG) ...
-
bioRxiv - Immunology 2022Quote: ... Human codon-optimized cDNA encoding SARS-CoV-2 spike glycoproteins of various strains were synthesized by GenScript and cloned into eukaryotic cell expression vector pcDNA 3.1 between the BamHI and XhoI sites ...
-
bioRxiv - Microbiology 2022Quote: ... Specific anti-CoV immunoreactivity was detected using SARS-CoV-2 nucleocapsid antibody (GenScript Biotech, Piscataway, NJ, USA) at a 1:1000 dilution ...
-
bioRxiv - Biochemistry 2021Quote: ... a SARS-CoV-2 S gene encoding residues 1-1138 (WuhanHu-1; GenBank: MN908947.3) was ordered (Genscript) and cloned into a pPPI4 plasmid containing a T4 trimerization domain followed by a hexahistidine tag by PstI-BamHI digestion and ligation ...
-
bioRxiv - Developmental Biology 2019Quote: Variant #1: a FseI-HH-gRN(#2)NA#1-HDV-HindIII fragment was de novo synthetized (Genscript). This contains a conditional gRNA#1 activatable by the gRNA#2 and flanked by the Hammerhead and HDV ribozymes (29) ...
-
bioRxiv - Microbiology 2021Quote: ... N501Y.V1 (Variant 1) mutant Spike proteins of SARS-CoV-2 were codon-optimized and synthesized by GenScript Inc (Nanjing ...
-
bioRxiv - Microbiology 2023Quote: ... A rabbit anti-SARS-CoV-2 neutralizing antibody (4G6) was purchased from Genscript (Cat. No. A02053-100). Rabbit monoclonal antibodies against 6-His-tags (12698S ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cDNA encoded the SARS-CoV-2 PLpro with mammalian codon optimization was also ordered from GenScript and cloned into the pcDNA 3.1 with an C-terminal FLAG tag ...
-
bioRxiv - Immunology 2023Quote: Lentiviral vectors for expression of SARS-CoV-2 spike (Delta variant B.1.617.2, NCBI accession # OX014251.1) were designed and synthesized from Genscript together with the two packaging plasmids (pMD2.G and psPAX2) ...
-
bioRxiv - Microbiology 2022Quote: ... Omicron BA 1.1 spike (from Dr. Raul Cachau, NIAID) or CoV-2 Spike RBD (His-Tag, Genscript) was diluted in phosphate buffered saline (PBS ...
-
bioRxiv - Immunology 2023Quote: ... NCBI accession # OX014251.1) and Sars-CoV-2 nucleocapsid (NCBI accession # OP359729.1) were designed and synthesized from Genscript together with the two packaging plasmids (pMD2.G and psPAX2) ...
-
bioRxiv - Immunology 2023Quote: ... the standard curve was run using SARS-CoV-2 neutralizing antibodies (GenScript #A02055 and #BS-M0220, respectively). Sample dilution and incubation were identical to the total IgG curve ...
-
bioRxiv - Biophysics 2023Quote: The codon optimized gene encoding the isoform 2 of full-length human HGSNAT was synthesized by GenScript. The synthesized gene was then cloned into the pEG BacMam expression vector (Addgene plasmid # 160683 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The solubilized supernatant fraction was incubated with 2 mL anti-FLAG affinity resin (GenScript Biotech, Piscataway, NJ) and stirred at 4°C for 2 hrs ...
-
bioRxiv - Biophysics 2021Quote: ... Samples were incubated for 5 minutes at 95 °C and run on a 4-20% gradient SDS-PAGE gel (Genscript).