Labshake search
Citations for GenScript :
451 - 500 of 932 citations for 1 2 Dihydro 1 2 tetrahydro 2H pyran 2 yl oxy ethyl 5H tetrazole 5 thione d4 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: The short labelled RNAs 5’ p-LU13-FAM (5’ p-GAGACAGUAUUUG-FAM) and 5’ OH-LU13-FAM (5’ OH-GAGACAGUAUUUG-FAM) were chemically synthesized by Genscript Biotech Corporation ...
-
bioRxiv - Synthetic Biology 2022Quote: ... carrying 5’-GCAATGCGTATCATTCTGCT and 5’-GCCGTCAACTTTCGCGTATT guide sequences (from GenScript USA Inc.). Positive colonies were selected by screening colonies with allele-specific PCR (Supplementary Table 4 ...
-
bioRxiv - Immunology 2023Quote: sgRNAs (PD-L1: 5’TCTTTATATTCATGACCTAC; CD155: 5’CCCGAGCCATGGCCGCCGCG) were chemically synthesized (GenScript). Ribonucleoproteins (RNPs ...
-
bioRxiv - Cell Biology 2020Quote: ... S100 supernatant was added directly to 600 μL of basic lysis buffer with protease inhibitors and NEM containing 30 μL 1:1 anti FLAG Affinity Gel (Genscript). All samples were incubated overnight at 4°C ...
-
bioRxiv - Biochemistry 2022Quote: The N-terminal peptides of ParBpSM (residues 1-27) and ParBP1 (residues 1-30) used in the ATPase assays were synthesized by GenScript. The sequence of ParBpSM1-27 and its variant ParBpSM1-27 K10A were NH2-MIVGNLGAQKAKRNDTPISAKKDIMGD-CO2H (≥97 % purity ...
-
bioRxiv - Molecular Biology 2022Quote: ... The coding sequences of human UBXN1 (Uniprot identifier Q04323-1) and FAF2 (Uniprot identifier Q96CS3-1) were synthesized by GenScript Biotech ...
-
bioRxiv - Immunology 2022Quote: ... et al (HPV16 E7) and Drakes et al (NY-ESO-1, 1G4 and MART-1, DMF5) were ordered from GenScript in the MSGV-retroviral vector (33 ...
-
bioRxiv - Cell Biology 2023Quote: ... residues 1-77) and human STX4 (lacking the transmembrane domain; residues 1-271 with 272C) were generated as synthetic genes (Genscript) with codon optimization for human expression ...
-
bioRxiv - Molecular Biology 2024Quote: ... or LV1-eGFP-miR-7 were generated by subcloning inserts from pAAV_hSYN1-eGFP-miR-7 and pAAV_hSYN1-eGFP (provided by Thomas B. Hansen) inside LV1 (immunodeficiency virus 1 (HIV-1)-based LV-PGK-GFP) backbone by GenScript Biotech Corporation ...
-
bioRxiv - Biophysics 2023Quote: The C-terminal 10mer peptides of nectin-1 and JAM-A (sequences in Supplementary Table 1) were purchased lyophilized from Genscript with N-terminal biotinylation and N-terminal FITC conjugation ...
-
bioRxiv - Microbiology 2023Quote: Genes encoding His-tagged ectodomain versions of the HSV-1 gD receptors HVEM (HVEM200t) or nectin-1 (nectin345t) were synthesized by GenScript (GenBank accession numbers AF060231 and U70321 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The genes for the designed HN protein variant 1 (HNv1) and F protein variant 1 (Fv1) were codon-optimized for expression in SJ and synthesized by Genscript® ...
-
bioRxiv - Developmental Biology 2022Quote: ... The blot was incubated with 10 μg/mL pre-biotin-CpOGACD for 1 h at room temperature followed by incubation with streptavidin-HRP (1:5000, M00091, GenScript) for 30 min.
-
bioRxiv - Immunology 2023Quote: ... DNA encoding HLA-C*05:01 (1-278) and β2M (1-99) were synthesized and cloned into pET30a by Genscript and were previously described42 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and guinea pig anti-Runt (1:600; GenScript). Rhodamine-phalloidin (Invitrogen R415 ...
-
bioRxiv - Developmental Biology 2021Quote: Anti-ApoB-1 antibodies were generated by GenScript USA (Piscataway ...
-
bioRxiv - Biochemistry 2020Quote: Glutathione S-Transferase (GST) (GenScript; Cat. # Z02039-1), ubiquitin (R&D Systems ...
-
bioRxiv - Immunology 2021Quote: ... and 1 mg/mL MOG35-55 peptide (Genscript). Mice were immunized on both flanks by subcutaneous injection of the emulsion for a total of 200 µL ...
-
bioRxiv - Cell Biology 2021Quote: ... Mouse anti-Tubulin antibody (1:10000, A01410, GenScript), rabbit anti-LaminB1 (1:5000 ...
-
bioRxiv - Microbiology 2020Quote: ... Mouse α-His antibody (1:1000, Genscript A00186) in TBST buffer with 0.5% BSA and goat α-mouse IgG (H+L ...
-
bioRxiv - Bioengineering 2020Quote: ... and 1 mM RGD (Ac-RGDSPGERCG-NH2) (GenScript). The other solution contained an 8mM di-cysteine modified Matrix Metalloprotease (MMP ...
-
bioRxiv - Molecular Biology 2021Quote: ... mouse anti FLAG-tag (1:500; A00187, GenScript). Anti-rabbit and anti-mouse secondary antibodies coupled to Alexa-488 ...
-
bioRxiv - Cell Biology 2023Quote: ... rabbit anti-tepsin 1:500 (in-house; Genscript) and 1:1000 (Robinson Lab ...
-
bioRxiv - Plant Biology 2023Quote: ... and 1 μM flg22 (RP19986; GenScript, Nanjing, China) or 1 µM RPH1 or 1 µM GFP proteins ...
-
bioRxiv - Microbiology 2023Quote: ... or rabbit anti-protein C (1:3000, GenScript) as primary antibodies ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 μM flg22 peptide (QRLSTGSRINSAKDDAAGLQIA, synthesized by Genscript), chitin (250 μg/ml) ...
-
bioRxiv - Biochemistry 2023Quote: LHa peptide (Table 1) was obtained from GenScript with a γ-aminobutanoate-mercaptopropionic acid linker (hereinafter referred to as LH2 peptide ...
-
bioRxiv - Cell Biology 2022Quote: ... rat-anti-Sasshort (1:50, GenScript USA Inc.); mAb Cq4 against crumbs (1:100 ...
-
bioRxiv - Microbiology 2022Quote: ... THE V5 Tag Antibody (1:2000, GenScript Biotech) was used as primary antibody for samples and mouse anti-clathrin heavy chain clone 23 (1:2,000 ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 pM and 1 pM of flg22 (GenScript) were infiltrated in leaves with a needleless syringe ...
-
bioRxiv - Biochemistry 2023Quote: ... anti-Coq1 (custom made at Genscript, 1:2000), anti-Vdac1 (Abcam ab110326 ...
-
bioRxiv - Bioengineering 2022Quote: ... a thiolated RGD peptide (GCGYGRGDSPG, 1 mM, GenScript), lithium acylphosphinate photoinitiator (LAP ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-Protein C (mouse, Genscript, A01774, 1:1000), anti-α-tubulin (mouse ...
-
bioRxiv - Microbiology 2024Quote: ... mouse monoclonal anti-Strep (Genscript A01732, 1:200), custom rabbit anti-mRnf213 antibody from an animal immunized with peptides RKSNEGGNTQPEDQRKPGEGR (aa296-316 ...
-
bioRxiv - Biophysics 2024Quote: ... Amyloid beta peptide (1-8: DAEFRHDS) from GenScript was co-crystallized with MBP-TREM2 N79Q by mixing at an 18:1 molar ratio prior to crystallization ...
-
bioRxiv - Bioengineering 2024Quote: ... aVHH (APC, 1:100, A01994; GenScript, Piscataway, NJ), (v ...
-
bioRxiv - Bioengineering 2024Quote: ... necator from GenScript (Additional file 1: Table S2) and PCR amplified with Q5 High-Fidelity 2X Master Mix (NEB) ...
-
bioRxiv - Cell Biology 2024Quote: ... Receptor was detected by primary rabbit anti-SNAP antibody (50 μL/well of 1:2000 dilution, GenScript, 1 h at RT) and anti-rabbit HRP antibody (50 μL/well of a 1:1000 dilution ...
-
bioRxiv - Genetics 2022Quote: ... PRDM9 (aa 1-416) and PRDM9dC (aa 1-371) were amplified from human cDNA purchased from GenScript (ORF Clone ID OHu03253). SETD2 (aa 1450-1645 ...
-
bioRxiv - Cancer Biology 2024Quote: ... NUSAP1-whole-mCherry (amino acids 1-441) and YY1-whole-mCherry (amino acids 1-414) fusion protein was synthesized by GenScript (Piscataway). Potassium phosphate buffer (pH 7.0 ...
-
bioRxiv - Plant Biology 2024Quote: ... Guide RNA sequences “5-CGUGUCACGACGGAGUGGAU-3” and “5-AUGUUGUAUGUGCCUAUACG-3” were synthesized by GenScript by adding the Cas12a scaffold sequence (5-UAAUUUCUACUCUUGUAGAU-3 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... a 1:200 biotinylated anti-Strep tag antibody (GenScript) treatment was followed by a 1:400 Streptavidin-BrilliantViolet 421 conjugate (Biolegend) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 1:200 iFluor647-conjugated mouse anti-His (Genscript A01802) for civet ACE2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The resulting cyk-1/Formin cDNA was synthesized (Genscript). In addition ...
-
bioRxiv - Neuroscience 2020Quote: ... The hDJ-1 L172Q mutant was synthesized by GenScript.
-
bioRxiv - Synthetic Biology 2020Quote: ... the mouse anti-His (A00186, GenScript, 1:5000 diluted), and the rabbit anti-HA (902303 ...
-
bioRxiv - Cell Biology 2020Quote: ... RGD peptide was purchased from Sigma-Aldrich and HYD-1 (KIKMVISWKG) was synthesized (Genscript, Piscataway, NJ). All reagents were 95% or greater purity and resuspended in deionized water ...
-
bioRxiv - Microbiology 2021Quote: Engineered inserts are outlined in Supplementary Table 1 (GenScript). All biosensor subunits were cloned into the BamHI/NotI sites of pcDNA3.1 to generate mammalian expression constructs.
-
bioRxiv - Biochemistry 2020Quote: ... rabbit anti-Hcp1 (P. aeruginosa) (diluted 1:5,000, Genscript) and detected with anti-rabbit horseradish peroxidase-conjugated secondary antibodies (diluted 1:5,000 ...
-
bioRxiv - Neuroscience 2022Quote: ... and Beta Actin (1:2000, A00702, GenScript, Piscataway, NJ). Membranes were then washed and probed with horseradish-peroxidase-conjugated donkey anti-mouse or anti-rabbit IgG (H+L ...