Labshake search
Citations for Takara Bio :
201 - 250 of 3750 citations for ssc mir 487b RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... Real-time RT-PCR analyses for viral RNA copy number was carried out with One Step PrimeScript™ III RT-qPCR Mix (Takara, Cat# RR600B) and reactions were performed by using LightCycler® 96 System (Roche Diagnostics GmbH ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and each RNA concentration was measured by quantitative PCR after reverse transcription using PrimeScript One Step RT-PCR Kit (TaKaRa) with each specific primer (Table S2).
-
bioRxiv - Microbiology 2022Quote: ... was used as the template for real-time RT-PCR performed according to the manufacturer’s protocol using the One Step TB Green PrimeScript PLUS RT-PCR kit (Takara-Bio) and the following primers ...
-
bioRxiv - Plant Biology 2022Quote: ... were amplified using a set of primers with Gateway attB sites (supplementary Table S2) and cloned into the pABAi vector (Cat. No. 630491, Takara Bio USA, Inc.). The MaMYBPA1 and MaMYBPA2 coding sequences were cloned into the pGADT7-GW vector (Clontech ...
-
bioRxiv - Biochemistry 2023Quote: ... The genes were amplified with [AgApiTpCold_F and R] and [Agr35256-2_F and R] primer sets (Supplemental Table S1) and cloned into the NdeI/XbaI sites of the pCold ProS2 vector (Takara Bio, Kusatsu, Japan). The resulting plasmid was transformed into E ...
-
bioRxiv - Molecular Biology 2020Quote: ... The coding sequence for the target protein was PCR amplified from pDONR223-CenpC40 (forward primer: CAGATCTCGAGTGGCTGCGTCCGGTCTGGA, reverse primer: TCCGGTGGATCCTTAGCATTTCAGGCAACTCTCCT) and inserted into pEGFP-Tub (BD Biosciences Clontech, Franklin Lakes, NJ, USA) with enzymes XhoI and BamHI replacing the tubulin sequence ...
-
bioRxiv - Genomics 2020Quote: ... 5X Primer Mix (P5 and P7 primers) and Terra™ PCR Direct Polymerase Mix 0.05 U/ µl at reaction (Takara Bio USA, CA, USA) via a thermal protocol ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Plant Biology 2019Quote: ... Quantitative RT-PCR was carried out with the SYBR Premix Ex Taq II (TaKaRa) on Applied Biosystems Step One Real-Time PCR system ...
-
bioRxiv - Systems Biology 2019Quote: ... The first-strand cDNA was amplified using PrimeScript RT-PCR kit from Takara (#RR104A). PCR products with the expected size (~400 bp for VH ...
-
bioRxiv - Microbiology 2021Quote: Reverse transcription and quantitative PCR reactions were performed using PrimeScript RT reagent Kit (Takara) and SYBR Premix Ex Taq II (Takara ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 ug RNA was reverse transcribed using a PrimeScript RT-PCR kit (Takara Bio) by following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Use the One Step TB Green® PrimeScript™ PLUS RT-PCR Kit (Takara) to quantify the viral RNA copies through the CFX96 Touch Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2022Quote: ... was reverse-transcribed into cDNA by PCR using PrimeScript™ RT Kit (TaKaRa, Japan). Then ...
-
bioRxiv - Plant Biology 2021Quote: ... cDNA was prepared by using the PrimeScript RT-PCR Kit (Takara Bio, Shiga, Japan). Quantitative RT-PCR (qRT-PCR ...
-
bioRxiv - Microbiology 2020Quote: ... and submitted to reverse transcription-quantitative PCR with the PrimeScript RT reagent kit (TaKaRa). The primers to detect Zika-specific RNA were listed below ...
-
bioRxiv - Bioengineering 2020Quote: ... Then qPCR was conducted with a One-Step PrimeScrip RT-PCR Kit (Takara, Japan), following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: RT-PCR detection of SAUR30 and UBQ5 expression was performed using ExTaq polymerase (TaKaRa) and the gene-specific primers listed in Supplemental Table S1.
-
bioRxiv - Plant Biology 2022Quote: ... Quantitative RT-PCR were carried out using TB Green Premix Ex Taq II (Takara). 1 μL of diluted cDNA was used for each reaction in a final volume of 15 μL ...
-
bioRxiv - Neuroscience 2023Quote: ... using the One-Step TB Green® PrimeScript™ RT-PCR Kit II (Takara) for RT-PCR ...
-
bioRxiv - Cell Biology 2023Quote: ... using the One-Step TB Green PrimeScript RT-PCR Kit II (Takara, Kyoto, Japan). Preparation of PCR reactions was automated by the Echo 525 Acoustic Liquid Handler (Beckman Coulter ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA was prepared from total RNA using the PrimeScript RT-PCR kit (Takara, #RR037Q). Relative gene expression of the cDNA was assayed using a 7500 Fast real-time PCR instrument (Applied Biosystems ...
-
bioRxiv - Plant Biology 2024Quote: ... The quantitative RT-PCR was performed on a Thermal Cycler Dice® TP800 (TaKaRa) with the SYBER® Premix Ex Taq TM II kit (TaKaRa ...
-
bioRxiv - Neuroscience 2021Quote: ... were reverse transcribed to complementary DNA (cDNA) using both oligo dT and random primers with PrimeScript RT Reagent Kit (Takara) according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... the gel-purified RNA was reverse transcribed into cDNA using a PrimeScript RT Reagent Kit with random primers (TAKARA, RR037B), followed by PCR with primers that can amplify transcripts across the splice junction ...
-
bioRxiv - Pathology 2019Quote: ... and then first-strand cDNA was synthesized from 1 μg total RNA using an oligo dT primer according to the protocol of PrimescriptII RT (TAKARA). PCR was performed with primer set 5574F and 3UTR that flanked the foreign insert to detect CGMMV and asses the stability of the pV190 and foreign inserts of CGMMV-based vectors (Table S1).
-
bioRxiv - Pathology 2020Quote: ... Single stranded cDNA was synthesized with the oligo(dT) primer using PrimeScript™ RT reagent Kit with gDNA Eraser (Takara), the obtained cDNAs were analyzed by real-time PCR ...
-
bioRxiv - Plant Biology 2019Quote: ... and oligodT primer were used for cDNA synthesis with PrimeScript RT Reagent Kit (Perfect Real Time) following the manufacturer’s instructions (Takara Bio). An amount of 5 μl of 25X dilute cDNA was used as a template for ddPCR reaction (total 20 μl ...
-
bioRxiv - Genomics 2022Quote: ... the primers used in this PCR carry partial Illumina adaptor sequences that permit indexing with Illumina dual-indexing primers in the second step PCR: after cleaning up with NucleoSpin Gel and PCR Clean-Up (Takara Bio), amplified barcodes were indexed using Q5 hot-start DNA polymerase (New England Biolabs ...
-
bioRxiv - Genetics 2022Quote: ... The primers are listed in the S8 Table and the PCR amplifications were performed using the CloneAmp™ HiFi PCR Premix (Takara). The pUAST-dCas9-KRAB plasmid was recombined into the attP site attP40 (BL #24749 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Promoterless bicistronic vectors were generated by removing the SV40 promoter from the bicistronic vector pRUF and the pRUF vectors containing the putative IRES sequences by PCR amplification using divergent primers (Supplementary Table 3) and the CloneAmp™ HiFi PCR Premix (Takara) polymerase ...
-
bioRxiv - Developmental Biology 2023Quote: ... At 48 hpf the GFP + progeny was genotyped using a forward primer in the foxo1a endogenous locus and a reverse primer in the EGFP inserted transgene using a touch-down PCR with the Terra™ PCR Direct Polymerase Mix (639270; Takara). The PCR product was run in a 1% agarose gel to validate its size and the remaining product was sent for Sanger sequence.
-
bioRxiv - Microbiology 2024Quote: ... the LHA and RHA PCR products were used as primers for amplifying the tsp exchange gene using CloneAmp HiFi PCR Premix (Takara Bio). After five PCR cycles ...
-
bioRxiv - Microbiology 2022Quote: RT-PCR was performed in a single closed tube using a one-step RT-PCR kit (One Step PrimeScript III RT-qPCR Mix, with UNG; Takara Bio Inc., Kusatsu, Japan) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and each RNA concentration was measured by quantitative PCR after reverse transcription using PrimeScript One Step RT-PCR Kit (TaKaRa, Japan) with specific primers (Table S2) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Gene expression in the cDNA samples was measured by one-step qRT-PCR using a One Step PrimeScript RT-PCR Kit (Perfect Real Time) according to the manufacturer’s specifications (Takara, Dalian, China). Quantitative real-time PCR was performed on the CFX Connect Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Microbiology 2022Quote: ... was used as the template for real-time RT-PCR performed according to the manufacturer’s protocol using the One Step TB Green PrimeScript PLUS RT-PCR kit (Takara, Cat# RR096A) and the following primers ...
-
bioRxiv - Microbiology 2021Quote: ... was used as the template for real-time RT-PCR performed according to the manufacturer’s protocol using the One Step TB Green PrimeScript PLUS RT-PCR kit (Takara, cat# RR096A) and the following primers ...
-
bioRxiv - Genomics 2022Quote: ... Total RNA from SARS-CoV-2 infected lung or trachea was subjected to one-step real-time reverse transcription PCR using One-step PrimeScript RT-PCR kit (Takara, RR064B). Multiplex PCR was performed to detect SARS-CoV-2 nucleocapsid gene and mouse Actb gene ...
-
bioRxiv - Cell Biology 2019Quote: ... This cDNA was used for real time PCR (RT-PCR) analysis using SYBR-Premix Ex Taq™ II (Tli RNaseH Plus) (Takara) with 10 pmol of specific primers ...
-
bioRxiv - Microbiology 2021Quote: ... was used as the template for real-time RT-PCR performed according to the manufacturer’s protocol using the One Step TB Green PrimeScript PLUS RT-PCR kit (Takara, Cat# RR096A) and the following primers ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... qRT-PCR was performed by using One Step SYBR® PrimeScript® PLUS RT-RNA PCR Kit (TaKaRa Biotechnology, Dalian, China). Relative expression levels were analyzed by using the 2−ΔΔCT method.
-
bioRxiv - Microbiology 2022Quote: ... The reverse transcription and the first round PCR were performed in a 25μl reaction volume by using PrimeScript™ One-Step RT-PCR Kit (TAKARA, RR055A). Cycling conditions were as follows ...
-
bioRxiv - Microbiology 2023Quote: ... was used as the template for real-time RT-PCR performed according to the manufacturer’s protocol using a One Step TB Green PrimeScript PLUS RT-PCR kit (Takara, Cat# RR096A) and the following primers ...
-
bioRxiv - Cancer Biology 2024Quote: ... Quantitative real-time RT-PCR (qRT-PCR) was performed using TB Green Premix Ex Taq ™ II (Tli RNaseH Plus) (Takara) with qTOWER3 (Jena) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... PCRs were performed with sample-specific tagged-primers using the Takara LA Taq polymerase (Takara) and 5 ng of DNA as input ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were originally obtained from ATCC and routinely tested negative for mycoplasma contamination (PCR Mycoplasma Detection Set, Takara).
-
bioRxiv - Plant Biology 2023Quote: ... The qRT-PCR reactions were set up with FastStart DNA Master SYBR Green I master mix (Takara, Japan). For each analysis ...
-
bioRxiv - Neuroscience 2023Quote: ... All cell lines were tested for mycoplasma contamination regularly with PCR Mycoplasma Detection Set (TaKaRa, Cat. no. 6601) and maintained under passage 20 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Real time PCR was set up using TB Green Premix Ex Taq II (Tli RNase H Plus) (TakaRa) in a Quantstudio5 machine ...