Labshake search
Citations for Takara Bio :
351 - 400 of 2168 citations for WD Repeat Containing Planar Cell Polarity Effector WDPCP Antibody Biotin since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: A DNA fragment containing CDS of each Hero protein and C-terminal FLAG and His tags was inserted into pCold I (Takara) by NEBuilder HiFi DNA Assembly Master Mix (NEB) ...
-
bioRxiv - Immunology 2022Quote: ... Culture supernatants containing lentivirus were collected 24 and 48 h after transfection and concentrated by a Lenti-X concentrator (Takara) followed by passing through a 0.45-μm PES filter ...
-
bioRxiv - Neuroscience 2022Quote: ... the PCR fragments containing InDels were cloned into pL253 at the NotI and SpeI sites via InFusion cloning (Takara #ST0344). Bacterial recombinants were screened via PCR using primers 253.S (caaggcgattaagttgggtaac ...
-
bioRxiv - Molecular Biology 2022Quote: ... Probes for FLuc (500 bp) were generated using gel-purified PCR amplicons containing GFP sequence and a BcaBEST Labeling kit (Takara) and [α-32P]-dCTP (PerkinElmer) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... each for a 50-µL reaction containing ∼30 fmol of EcoRI-XbaI digested pLVSIN-CMV-Pur backbone plasmid (Takara #6183), ∼300 fmol of the insert fragment ...
-
bioRxiv - Bioengineering 2023Quote: ... with each 20 μl of PCR mixture containing 10 μl of TB Green Premix Ex Taq II (Tli RNase H Plus, Takara), 0.4 μl of each PCR forward and reverse primers (10 μM) ...
-
bioRxiv - Biochemistry 2023Quote: ... into which a PCR-amplified DNA fragment containing the mNeonGreen gene (Shaner et al., 2013) was inserted using the in-Fusion reaction (Clontech). To generate pRS426-CPY(1-50)-ATG15(Δ1-35)-mNeonGreen (YPL073) ...
-
bioRxiv - Immunology 2023Quote: ... and GC B cells (live singlet CD19+ CD4− IgDlo CD71+CD38int CD20+ CXCR5+) were sorted using a FACSAria II into 96-well plates containing 2 μL Lysis Buffer (Clontech) supplemented with 1 U μl−1 RNase inhibitor (NEB) ...
-
bioRxiv - Plant Biology 2023Quote: ... and was cloned into the AscI site of the pENTR/D-TOPO entry vector containing full length MpNEK1 CDS (Otani et al., 2018) by In-fusion system (Takara). The resulting vector pENTR/D-TOPO-MpNEK1-mCitrine was subjected to LR reaction to transfer MpNEK1-Citrine fusion into the Gateway binary vector pMpGWB144 (MpEF1α pro:XVE >>LexA operator:Gateway cassette).
-
bioRxiv - Molecular Biology 2023Quote: ... Total protein was lysed by homogenization in radioimmunoprecipitation (RIPA) buffer (FUJIFILM) containing protease inhibitor cocktail (NACALAI TESQUE) and Cryonase Cold-active Nuclease (TAKARA), while total RNA was extracted using an RNeasy Mini Kit (Qiagen) ...
-
bioRxiv - Neuroscience 2023Quote: ... Pelleted nuclei were then washed in 4 mL of Nuclei Suspension Buffer containing 0.2% RNase inhibitor (Clontech/Takara, Cat. 2313B) and centrifuged at 500xg for five minutes at 4°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... The construct containing Y181G-coding point mutation was generated by inverse PCR of Zdhhc20WT plasmid using CloneAmp HiFi PCR Premix (Takara) and joining the ends of the PCR product using InFusion cloning.
-
bioRxiv - Neuroscience 2023Quote: ... Pelleted nuclei were then washed in 4 mL of Nuclei Suspension Buffer containing 0.2% RNase inhibitor (Clontech/Takara, Cat. 2313B) and centrifuged at 500xg for five minutes at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA was synthesized with the PrimeScript 1st Strand kit with an additional primer mix containing random DTs (#RR047A and #6110A, Takara). cDNAs were amplified using specific Taqman probes ...
-
bioRxiv - Neuroscience 2023Quote: ... we harvested 10-12 GFP+ cells per fly into 0.5ul nuclease free water in the pipette tip and then the tip was broken into a 96 well PCR tube containing RNAse inhibitors and buffer as described by Clontech’s ultra low HV SMARTer Ultra Low RNAseq kit (Catalog #634823) ...
-
bioRxiv - Plant Biology 2023Quote: ... diluted to 1 µg/mL with Milli-Q ultra-pure water for 5 min at room temperature or with a pollen germination medium containing 2000-fold SYBR Green I (Cat#: 5760A, Takara) and 5 µg/mL DAPI (Cat# 10236276001 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Growth media was changed the following day and lentiviruses-containing supernatants were harvested at 72 hr after transfection and concentrated 100-fold using Lenti-X concentrator (Clontech). For infection ...
-
bioRxiv - Immunology 2023Quote: ... into 96-well plates containing 12.5μl CDS sorting buffer as described in the SMART-Seq® HT Kit protocol (Takara Bio). Full-length cDNA amplification of single cells was performed per the kit protocol (Takara Bio) ...
-
bioRxiv - Microbiology 2024Quote: ... The EnvV2-Fca gene was amplified using primers Fe-gvm2Env-F and Fe-gvm2Env-R and detected using probe Fe-gvm2Env-P (containing 6-carboxy-fluorescein; FAM) (Takara). The internal control ...
-
bioRxiv - Plant Biology 2023Quote: ... the Y2HGold strain was transformed with the bait vector (pGBKT7-SR45) and then mated with strain Y187 containing an Arabidopsis cDNA library (Mate and Plate Library-Universal Arabidopsis, Clontech) (Stankovic et al. ...
-
bioRxiv - Cell Biology 2021Quote: A549 cells (purchased from JCRB cell bank, Japan (JCRB0076)) and Lenti-X 293T cells (Takara Bio, Japan) were cultured in high-glucose Dulbecco’s modified Eagle’s media (DMEM ...
-
bioRxiv - Cell Biology 2022Quote: For HEK293T transduction: HEK293T cells (LentiX 293T cell line, Takara) were transfected in 10 cm dishes with packaging plasmid psPAX2 ...
-
bioRxiv - Cell Biology 2020Quote: ... and GFP was probed with the monoclonal JL8 antibody (Takara) and anti-mouse HRP conjugate secondary (Promega W401B) ...
-
bioRxiv - Cell Biology 2020Quote: ... the following antibodies were used: Rabbit anti-dsRed (Clontech #632496) 1:1,000 ...
-
bioRxiv - Neuroscience 2020Quote: ... Primary antibodies used were mouse anti-STEM121 (1:500; Takara), chicken anti-GFAP (1:2,000 ...
-
bioRxiv - Neuroscience 2019Quote: ... anti-dsRed (1:1000, Living Colors DsRed Polyclonal Antibody, Takara). After rinsing 5x 10 min each in PBST ...
-
bioRxiv - Physiology 2020Quote: ... followed by incubation with DsRed Polyclonal Antibody (Takara Bio # 632496) overnight in PBST (0.2% ...
-
bioRxiv - Neuroscience 2019Quote: ... Primary antibodies used were: rat monoclonal mCherry (1:2000, Clontech); mouse monoclonal tyrosine hydroxylase (TH ...
-
bioRxiv - Plant Biology 2020Quote: ... the YFP protein was detected using the GFP antibody (Clontech) at 1/5,000th and the UGPase antibody (Agrisera ...
-
bioRxiv - Neuroscience 2020Quote: ... Primary antibodies used were as follows: rabbit anti-DsRed (Clontech) – 1:2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse GFP antibody (Clontech, clone JL8, used at 1:4,000) was obtained from Takara (Saint-Germain-en-Laye ...
-
bioRxiv - Neuroscience 2022Quote: ... a mouse anti-mCherry primary antibody (Takara Bio, 1:5000) was used instead of the substance P primary antibody to visualize hM3Dq-mCherry or mCherry-expressing cells.
-
bioRxiv - Genetics 2020Quote: ... using monoclonal antibodies against Cas9 (Clontech, Palo Alto, CA, USA) or GFP (Sigma) ...
-
bioRxiv - Cell Biology 2020Quote: Mouse GFP antibody (Clontech, clone JL8, used at 1:4,000) was obtained from Takara (Saint-Germain-en-Laye ...
-
bioRxiv - Neuroscience 2023Quote: ... Green Fluorescent Protein (GFP) antibody (JL-8, 1:500, Clontech), Red Fluorescent Protein Antibody (DsRed ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-DsRed antibody (Living colors/Takara Bio, RRID: AB_10013483) and mounted in Vectashield (Vector labs ...
-
bioRxiv - Developmental Biology 2022Quote: ... anti-E-cadherin rat monoclonal antibody (Takara, M108, 1:500), anti-GFRα1 goat polyclonal antibody (R&D Systems ...
-
bioRxiv - Neuroscience 2022Quote: ... and iv) a polyclonal rabbit anti-DsRed antibody (632496, Clontech) diluted 1:200 in 3% PBT (for detecting the DenMark signal to label post-synaptic regions).
-
bioRxiv - Cancer Biology 2022Quote: ... Rabbit polyclonal antibodies used were: HECD1 (anti-E-cadherin; Takara), anti-Melan-A (ab15468 ...
-
bioRxiv - Neuroscience 2023Quote: ... a Living Colors® EGFP mouse monoclonal antibody (632569, Clontech), or a mouse monoclonal anti-actin antibody (clone AC-40 ...
-
bioRxiv - Neuroscience 2023Quote: ... and Living Colors® DsRed Polyclonal Antibody (1:200, Clontech). BrdU ...
-
bioRxiv - Cell Biology 2024Quote: ... Primary antibodies were diluted using Solution 1 (Takara, NKB-101). Secondary antibodies used for immunoblotting included peroxidase AffiniPure Goat Anti-Rabbit IgG (H+L ...
-
bioRxiv - Developmental Biology 2024Quote: ... and/or 1:200 anti-N-cadherin antibodies (TAKARA, M110) in 1% blocking regent (Roche ...
-
bioRxiv - Developmental Biology 2024Quote: ... Primary antibodies used were CDH1 (E-CADHERIN) (M106, Takara Biosciences) for glandular and luminal epithelial staining ...
-
bioRxiv - Genetics 2024Quote: ... its antibody was removed by stripping buffer (Takara Bio #T7135A) and re-blotted by PKcs antibody to quantify the total amount of DNA-PKcs (See Figures S2I-L).
-
bioRxiv - Cell Biology 2024Quote: ... 1:1000 anti-tdtomato rabbit primary antibody (#632496 from Takara), 1:1000 anti β-tubulin mouse primary antibody ...
-
bioRxiv - Microbiology 2019Quote: ... coli cells (Takara) and selected on LB-Ampicillin plates ...
-
bioRxiv - Biochemistry 2020Quote: ... coli cells (TaKaRa) were transformed with these plasmids for amplification and DNA storage ...
-
bioRxiv - Genetics 2022Quote: ... StellarTM cells (Takara) were transformed with the resulting plasmids ...
-
bioRxiv - Genetics 2022Quote: ... StellarTM cells (Takara) were transformed with the resulting plasmids ...