Labshake search
Citations for Takara Bio :
201 - 250 of 1129 citations for Transcription Factor SOX 10 SOX10 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... total RNA was converted into first strand complementary DNA (cDNA) using a Reverse Transcription Kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2021Quote: ... 500 ng total RNA was used for reverse transcription with PrimeScript RT with gDNA eraser (Takara). For relative transcript quantification PowerUp SYBR Green (Applied Biosystems ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Transcription template DNA fragments were amplified directly by PCR using PrimeStar Max PCR polymerase (Takara Bio), SPu-2 (5’–CAGTAAGCCAGATGCTACAC ...
-
bioRxiv - Molecular Biology 2021Quote: ... Reverse transcription was carried out using PrimeScript RT Master Mix (Takara Bio, Otsu, Japan. Ref: RR036A). Optical density analysis using a Nanodrop ND-1000 spectrophotometer (Labtech ...
-
bioRxiv - Cell Biology 2020Quote: ... and reverse transcription of mRNA was conducted using the PrimeScript™ RT reagent Kit (Takara, RR047Q) with oligo(dT ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and used as a template in reverse transcription with the SMART cDNA Library Construction Kit (Clontech). cDNA fragments amplified using the degenerate primers designed based on the ortholog sequences of close relatives were sequenced with a 3730xl DNA Analyzer (Thermo Fisher Scientific) ...
-
bioRxiv - Genetics 2022Quote: ... Reverse transcription for quantitative PCR (qPCR) analyses was performed with PrimeScript RT Master Mix kit (Takara). qPCR was performed with TransStart Top Green qPCR SuperMix kit (TransGen).
-
bioRxiv - Molecular Biology 2022Quote: ... was used for oligo(dT)18-primed cDNA synthesis according to the reverse transcription protocol (TaKaRa). The resulting cDNA was subjected to relative quantitative PCR using the SYBR Premix Ex Taq kit (TaKaRa ...
-
bioRxiv - Plant Biology 2022Quote: ... 400 ng of purified RNA were subjected to reverse transcription using the PrimeScriptRT Reagent Kit (TaKaRa).
-
bioRxiv - Microbiology 2023Quote: ... Reverse transcription products were then subjected to qPCR with a commercial kit (TAKARA, Cat. No. RR820Q) to amplify GAPDH (Forward primer ...
-
bioRxiv - Genetics 2023Quote: ... Reverse transcription and quantitative real-time PCR were performed with PrimeScriptTM RT Master Mix (Takara, RR037A) and TB Green Premix Ex TaqTM II (Takara ...
-
bioRxiv - Immunology 2023Quote: ... The viral copies were quantitated by reverse transcription quantitative PCR following the handbook (Takara, Cat.#RR086A). The copy numbers of reverse-transcripts from cell cultures and mice organ samples were normalized with the expression level housekeeping gene of beta-actin by using the 2(-Delta Delta C(T) ...
-
bioRxiv - Developmental Biology 2024Quote: ... and cDNA synthesis was followed by retrotranscribing reverse transcription with primer transcript II reverse transcriptase (Takara) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... which was conducted using oligo-dT-primed reverse transcription with SMARTScribe reverse transcriptase (Clontech, Cat#: 639538) and a locked nucleic acid containing template-switching oligonucleotide (TSO ...
-
bioRxiv - Cell Biology 2023Quote: ... Reverse transcription of RNA to cDNA was performed using the PrimeScript RT Reagent kit (RR037A, Takara). Quantitative RT-PCR was then performed on the cDNA using TB Green Premix Ex Taq II (RR820A ...
-
bioRxiv - Microbiology 2023Quote: ... Reverse transcription and amplification were performed using One Step PrimeScript™ RT-PCR Kit (Takara, Japan) and reaction performed and visualized using Stratagene Mx3000P qPCR System real-time PCR system (Agilent ...
-
bioRxiv - Developmental Biology 2023Quote: ... and reverse transcribed to synthesize cDNA using a PrimeScript RT Master Mix reverse transcription kit (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... and one μg of RNA was reverse transcribed using a cDNA Reverse Transcription Kit (RR037A, Takara). Final cDNA samples were used then used for quantitative real-time PCR assay by SYBR Green PCR Kit (RR820A ...
-
bioRxiv - Pathology 2024Quote: ... following the manufacturer’s instructions and used for reverse transcription with the PrimeScriptTM RT reagent Kit (TaKaRa).The sequences of FaMyo5 motor domains were amplified from the cDNAs of all the F ...
-
bioRxiv - Cell Biology 2023Quote: ... 400 ng of RNA was used for reverse transcription using PrimeScript RT Master Mix (Takara, USA). PCR reactions were performed using TB Green Premix Ex Taq (Takara ...
-
bioRxiv - Microbiology 2024Quote: ... Reverse transcription of RNA was performed using PrimeScriptTM reagent Kit (Perfect Real Time) (Takara Bio Inc.) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... All RNA clones were prepared from the plasmids by in vitro transcription with T7 RNA polymerase (Takara) after digestion with Sma I (Takara) ...
-
bioRxiv - Immunology 2021Quote: ... Reverse transcription was performed with a PrimeScript RT Reagent Kit with gDNA Eraser (Takara, Cat no. RR047A) and qRT-PCR was performed on a StepOnePlus Real-time PCR system (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2019Quote: ... and then cDNA was synthesized using the PrimeScript reverse transcription (RT) reagent kit (6210B; Takara Bio. Inc.) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... and subsequently subjected to reverse transcription using PrimeScript™ RT reagent Kit (TaKara Bio, Mountain View, CA). Quantitative real-time PCR was performed with Premix Ex Taq (TaKara Bio ...
-
bioRxiv - Neuroscience 2020Quote: ... spectrophotometer followed by reverse transcription reaction to produce cDNA using PrimeScript RT Reagent Kit (Takara, Clonetech, Japan). Specific primers against the genes of interest (Table 3 ...
-
bioRxiv - Microbiology 2020Quote: ... Reverse transcription was performed with a PrimeScript RT Reagent Kit with gDNA Eraser (Takara, Cat no. RR047A) and qRT-PCR was performed on StepOne Plus Real-time PCR system (Applied Biosystem ...
-
bioRxiv - Plant Biology 2021Quote: ... Reverse transcription of RNAs were carried out using PrimeScript II 1st strand cDNA Kit™ (Takara, Japan). The coding sequences of DGAT1s were amplified by a high-fidelity KOD-Plus-Neo polymerase (Toyobo ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Reverse-transcription and cDNA amplification were performed with SMARTer® PCR cDNA Synthesis Kit (Clontech Laboratories, Inc.) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... at least 20 ng of input RNA was used for reverse transcription with SMARTscribe reverse transcriptase (Clontech). Whole transcriptome amplification (WTA ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and was reverse-transcribed into cDNA using a high-capacity cDNA reverse transcription kit (TAKARA, Tokyo, Japan) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2021Quote: ... and total RNA was reverse-transcribed into cDNA by a reverse transcription kit (Takara Bio Inc., Japan). Then ...
-
bioRxiv - Microbiology 2020Quote: cDNAs were synthesized by reverse transcription using a PrimeScript II 1st Strand cDNA Synthesis Kit (Takara Bio). Total RNA (1 μg ...
-
bioRxiv - Microbiology 2021Quote: ... and the in vitro Transcription T7 kit (for siRNA synthesis; No. 6140, TaKaRa Bio Inc., Kusatsu, Japan) was used ...
-
bioRxiv - Neuroscience 2022Quote: ... Reverse transcription with 1 μg of total RNA was conducted using PrimeScript™ RT Master Mix (Takara) following the manual ...
-
bioRxiv - Cell Biology 2022Quote: ... and mRNA reverse transcription was performed with the PrimeScript RT Reagent Kit with gDNA Eraser (Takara, Japan). The qPCR was performed using SYBR Green qPCR Master Mix (Takara ...
-
bioRxiv - Genetics 2022Quote: ... Reverse transcription for cDNA cloning was performed with PrimeScript™ II 1st Strand cDNA Synthesis kit (Takara), Gibson assembly was performed with NEBuilder HiFi DNA Assembly Master Mix ...
-
bioRxiv - Immunology 2023Quote: ... followed by RNA reverse transcription by SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Clontech). After enzymatic fragmentation of cDNA samples by KAPA Frag kit (KAPA Biosystems) ...
-
bioRxiv - Biochemistry 2022Quote: ... from which cDNA was obtained by reverse transcription using the PrimeScript RT Reagent Kit (TaKaRa, Kusatsu, Japan). Transcript levels of RvNaRL were examined using a real-time PCR system (LightCycler 96 system ...
-
bioRxiv - Cancer Biology 2024Quote: ... sgRNAs efficiency was assessed in vitro using the sgRNA In vitro Transcription and Screening kit (Clontech, 631439) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed by SYBR Green PCR Master Mix (Takara). The primer sequences for qRT-PCR were listed in Table S15.
-
bioRxiv - Cancer Biology 2023Quote: ... Reverse transcription of RNA was carried out using the PrimeScript RT reagent Kit with gDNAEraser from TAKARA. The resulting cDNA from reverse transcription was then amplified by PCR and digested using PstI ...
-
bioRxiv - Microbiology 2024Quote: ... The reverse transcription was performed using the PrimeScript RT reagent kit (Takara, Saint-Germain-en-Laye, France) with a primer oligo-d(T)-AP (5’ GACCACGCGTATCGATGTCGACTTTTTTTTTTTTTTTTv 3’) ...
-
bioRxiv - Biophysics 2021Quote: ... 10% FBS (Clontech), 50 U/mL penicillin ...
-
bioRxiv - Immunology 2021Quote: ... and quantitative reverse transcription-polymerase china reaction (RT-qPCR) was performed using SYBR Premix Ex Taq (TaKaRa, China). All procedures were performed following the manufacturer’s protocols.
-
bioRxiv - Molecular Biology 2019Quote: ... the cDNA was synthesized by reverse transcription using PrimeScript RT reagent kits with gDNA Eraser (Takara, Dalian, China) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2019Quote: ... 500 ng RNA was DNAse I-treated (ThermoFischer Scientific) and submitted to reverse transcription (Takara PrimeScript™ RT). Before qPCR ...
-
bioRxiv - Molecular Biology 2021Quote: ... Three μg of total RNA was subjected to reverse transcription using PrimeScript 1st strand cDNA Synthesis Kit (Takara).
-
bioRxiv - Neuroscience 2020Quote: ... reverse transcription and amplification was achieved using the SMART-Seq v4 ultra low input RNA Kit (Takara, 634891). This kit improves synthesis of the full-length cDNA via a template switching mechanism for synthesis of the second strand cDNA ...
-
bioRxiv - Microbiology 2021Quote: ... Reverse transcription was done using PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time) (Takara, #RR047A). qPCR reaction was prepared by TB Green® Premix Ex Taq™ (Tli RNaseH Plus ...