Labshake search
Citations for Takara Bio :
301 - 350 of 1121 citations for Toscana Virus Glycoprotein 2 Gc Human Heterodimeric Fc tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2019Quote: ... Human iPSC line (XY) was obtained from Takara, and Human H9 ESC line (WA09 ...
-
bioRxiv - Cell Biology 2020Quote: Human Embryonic Kidney 293 (HEK293) cells (Clontech Laboratories) were used for most experiments described in this study ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-human specific cytoplasm (TAKARA, Stem121, 1:500), anti-TBR2 (Abcam ...
-
bioRxiv - Neuroscience 2023Quote: Human embryonic kidney 293T (HEK293T/HEK293LE; Clontech 632180) cells were cultured in DMEM with 10% fetal bovine serum (Fisher #10082-147 ...
-
bioRxiv - Genetics 2023Quote: Human embryonic kidney cells (HEK293T, Takara Bio #632180)) were cultured in DMEM-GlutaMAX media (10566024 ...
-
bioRxiv - Neuroscience 2024Quote: Human embryonic kidney 293T cells (#632273, Takara Bio) were used to produce AAVs ...
-
bioRxiv - Cancer Biology 2020Quote: ... Virus was collected after 24 hours for 3 consecutive days and concentrated with Lenti-X Concentrator (Takara Bio USA, Mountain View, CA). A mixture of two shRNA constructs for SPCA2 was used ...
-
bioRxiv - Microbiology 2020Quote: ... RNAs extracted from 100 µl of virus-containing supernatants or PBMCs were amplified by using a PrimeScript® RT reagent Kit (Perfect Real Time) (Takara Bio) and 5’RACE was performed by using a 5’RACE System for Rapid Amplification of cDNA Ends ...
-
bioRxiv - Neuroscience 2021Quote: ... After the immortalization procedure the absence of virus was verified using the Lenti-X p24 Rapid Titer Kit (Takara Bio USA, #632200).
-
bioRxiv - Cancer Biology 2020Quote: ... Virus was collected after 24 hours for 3 consecutive days and concentrated with Lenti-X Concentrator (Takara Bio USA, Mountain View, CA). A mixture of two shRNA constructs for SPCA2 was used ...
-
bioRxiv - Cancer Biology 2023Quote: Production of vesicular stomatitis virus (VSV-G) pseudotyped lentivirus was performed by calcium phosphate transfection of Lenti-XTM 293T cells (TaKaRa Clontech, 632180) with CROP-mCherry and helper plasmids pMD2.G and psPAX2 (Addgene plasmids 12259 and 12260) ...
-
bioRxiv - Microbiology 2023Quote: Standards for determining copy number of virus stock were prepared using the PrimeScript II High Fidelity One Step RT-PCR Kit (TaKaRa, Cat# R026A) with IAV (H1N1 ...
-
bioRxiv - Cell Biology 2020Quote: The cDNA coding sequences of the first and second cytoplasmic loop domain of human TMEM39A were cloned into the pGBKT7 vector and screened against a normalized universal human cDNA library (Clontech, 630481), following instruction of the Matchmaker® Gold Yeast Two-Hybrid System (Clontech ...
-
bioRxiv - Genetics 2020Quote: The cDNA coding sequence of the C-terminal domain of human TMEM132D was cloned into the pGBKT7 vector and screened with a normalized universal human cDNA library (Clontech, 630481) in pGADT7 Vector ...
-
bioRxiv - Cancer Biology 2023Quote: Lentiviral vectors for expression of LDHA or LDHB were generated by PCR amplification of the respective cDNAs from plasmids obtained from the Eugene McDermott Center for Human Growth and Development Sequencing Core Human ORF Collection and cloning into pLVX-IRES-Puro (Takara 632183) through Gibson assembly (NEB E2621) ...
-
bioRxiv - Cell Biology 2023Quote: ... and of human FAM104B isoform 3 (NM_001166700.2) were PCR- amplified from a yeast two-hybrid human testis cDNA library (Clontech, cat. no. 638810) and cloned via appropriate restriction sites into pGAD-C1 (James et al ...
-
bioRxiv - Molecular Biology 2020Quote: ... To generate the light-inducible clustering constructs, the CRY2olig sequence (Taslimi et al., 2014a) was inserted with a c-terminal mCherry tag (Clontech) into pGEMHE to generate pGEMHE-CRY2olig-mCherry ...
-
bioRxiv - Developmental Biology 2019Quote: ... The human HSF2-YFP was constructed by PCR and cloned into the XhoI and SalI sites in frame with the N-terminal YFP tag in EGFp-C1 plasmid using In-Fusion Kit (Clontech). All PCR-amplified products for both plasmids were sequenced to exclude the possibility of second site mutagenesis ...
-
bioRxiv - Developmental Biology 2019Quote: ... plasmid after digestion of the inserts by EcoRI and KpnI and cloning into the EcoRI and EcoRV sites in frame with the C-terminal Flag tag in pSNAPf plasmid using In-Fusion Kit (Clontech). The human HSF2-YFP was constructed by PCR and cloned into the XhoI and SalI sites in frame with the N-terminal YFP tag in EGFp-C1 plasmid using In-Fusion Kit (Clontech) ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and a modified vector with an N-terminal AviTag for biotinylation and C-terminal His6-tag (p28BIOH-LIC) using a ligation-independent InFusion cloning kit (ClonTech) and verified by DNA sequencing ...
-
bioRxiv - Microbiology 2019Quote: ... These PCR products were cloned into pCA24N with a C-terminal GFP tag using the In-Fusion HD enzyme kit (Takara). Clones were selected on TSA plates with 50µg/ml chloramphenicol ...
-
bioRxiv - Cancer Biology 2019Quote: ... containing a c-terminal Influenza Hemagglutinin (HA) reporter tag was cloned into the backbone pLX317-empty using the In-Fusion cloning kit (Clontech). The backbone was cut with BamHI and EcoRI.
-
bioRxiv - Cell Biology 2021Quote: ... cells were stably transfected with a plasmid encoding human full-length keratin 8 with an EYFP tag at its carboxyterminus (Windoffer et al., 2004; recloned into pEYFP-N1 (Clontech) with BamHI and EcoRI) ...
-
bioRxiv - Biophysics 2021Quote: ... A cDNA coding for 128QHTT with C-terminal fusion to a FLAG-His affinity tag was cloned into the vector pTRE-tight-BI-AcGFP1 (Clontech) for expression of 128QHTT upon induction with Dox ...
-
bioRxiv - Biochemistry 2020Quote: ... Full-length EGFP fused N-terminally to a nuclear localization signal (NLS) and C-terminally to a Myc-tag was expressed from pCMV (Clontech).
-
bioRxiv - Microbiology 2019Quote: ... mIRE1-wt was PCR-amplified (without a myc tag) from pcDNA3-mIRE1-3xmyc (Stahl et al, 2013) and subcloned in pMSCVhyg (Clontech) using BglII and HpaI sites ...
-
bioRxiv - Cell Biology 2022Quote: 3’ NotI-STOP-ORD5_Rv GCACA GCGGCCGC ctactgtggccggagggctggtcg For the HA-ORP5 cloning the PCR product (carrying the HA tag at the N-terminus of ORP5) was ligated between AgeI and XhoI in the pEGFP-C1 vector (Clontech) and replacing the GFP- with the HA-tag ...
-
bioRxiv - Microbiology 2020Quote: ... Total viral DNA was extracted using Qiagen viral DNA extraction kit (QIAamp DNA Mini Kit, Hilden, Germany) and DNA polymerase Tag (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmid pTAP-AFAP was constructed by cloning the gene fragment encoding AFAP-streptavidin-binding peptide-3xFLAG tag fusion protein (AFAP-SBP-3xFLAG, shorted as AFAP-SF) into mammalian expression vector pIRESpuro3 (Takara). SBP is a peptide with the length of 38 amino acids (Wilson et al. ...
-
bioRxiv - Molecular Biology 2019Quote: ... The cell debris was removed upon centrifugation and the proteins were purified from the supernatant by His-tag affinity chromatography using Ni-NTA agarose beads (Clontech). The bound proteins were washed with lysis buffer containing 10 mM imidazole and then eluted with lysis buffer containing 250 mM imidazole ...
-
bioRxiv - Pathology 2019Quote: ... and 1-1249 (full-length) were cloned into an EGFPC1 plasmid (N-terminal GFP tag) (Takara Bio, Mountain View, CA). For cleavage site validation experiments ...
-
bioRxiv - Biochemistry 2019Quote: ... The cell debris was removed upon centrifugation in a SS34 rotor at 4 °C (27,000 × g for 15 min) and the proteins were purified from the supernatant by His-tag affinity chromatography using Ni-NTA agarose beads (Clontech). The bound proteins were washed with lysis buffer containing 25 mM imidazole and then eluted with lysis buffer containing 500 mM imidazole ...
-
bioRxiv - Genomics 2019Quote: ... we prepared whole genome sequencing libraries using 1 ng input from healthy volunteer samples using ThruPLEX Tag-seq (Takara Bio). We performed sequencing on HiSeq 4000 (Illumina ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... were subcloned into a pcDNA3.1 vector for mammalian expression and a C-terminal HA-tag (YPYDVPDYA) was add using In-Fusion HD Cloning technology (Clontech). A plasmid encoding the G protein chimera GqGi3 bearing the core of human Gαq and the last 4 amino acid of Gαi3 was generated by primer mutagenesis and In-Fusion HD Cloning (Clontech ...
-
bioRxiv - Neuroscience 2021Quote: ... AP-MDGA1 and AP-MDGA2 were generated by replacing the V5 tag of the V5-MDGA1 and V5-MDGA2 constructs respectively by the 14 amino acids AP tag (5’GGCCTGAACGAtATCTTCGAGGCCCAG AAGATCGAGTGGCACGAG3’) using the HD-In-Fusion kit (Takara). The linker 5’GGAGGATCAGGAGGATCA3’ was added after the AP tag ...
-
bioRxiv - Biophysics 2020Quote: pDNA_HaloTag/SNAP-tag/GFP vectors encoding each target protein (see Note 1),which were inserted by In-Fusion HD Cloning Kit (Clontech) or Seamless Ligation Cloning Extract (SLiCE ...
-
bioRxiv - Developmental Biology 2020Quote: ... This allowed the HA tags to be replaced with GFP (amplified with primers including the AatII sites from pEGFP-N1 (Clontech). Forward primer ...
-
bioRxiv - Microbiology 2020Quote: ... and tandem repeat Sgo_R3-4 (aa 621– 789) were cloned downstream of a hexahistidine tag and 3C protease specific linker by the In-fusion method (Clontech; primer sequences listed in Supplementary Table 1) ...
-
bioRxiv - Biochemistry 2020Quote: ... siRNA resistant WRN transgenes containing a C-terminal 3xFLAG tag (designated WRNr) were synthesized and inserted into the lentiviral pLVX-IRES-puro plasmid vector (ClonTech) at GenScript ...
-
bioRxiv - Cancer Biology 2021Quote: ... and HRas was purified via its 6His affinity tag using immobilized metal affinity chromatography (TALON® Metal affinity resin (Takara)) followed by elution using an imidazole step gradient ...
-
bioRxiv - Molecular Biology 2019Quote: A DNA fragment containing CDS of each Hero protein and C-terminal FLAG and His tags was inserted into pCold I (Takara) by NEBuilder HiFi DNA Assembly Master Mix (NEB) ...
-
bioRxiv - Microbiology 2022Quote: MHV68 FLAG tagged ORF45 and ORF65 were subcloned into the XhoI and NotI sites of pcDNA4/TO-3xFLAG (N-terminal tag) to generate pcDNA4/TO-3xFLAG-ORF45 or ORF65 using InFusion cloning (Clontech). ORF45 and ICP0 was subcloned into the BamHI and XhoI sites of pcDNA4/TO-2xStrep (N-terminal tag ...
-
bioRxiv - Microbiology 2022Quote: ... ORF45 and ICP0 was subcloned into the BamHI and XhoI sites of pcDNA4/TO-2xStrep (N-terminal tag) to generate pcDNA4/TO-2xStrep-ORF45 using InFusion cloning (Clontech). Deletion mutants of 2xStrep-ORF45 were generated using site-directed mutagenesis PCR with Q5 DNA Polymerase (New England Biolabs ...
-
bioRxiv - Biochemistry 2023Quote: ... Tm1 FL for motility assays was cloned with a HisSUMO-SNAP-tag between SacI and HindIII sites of the pET11 vector by InFusion cloning (Takara). The SNAP-Tm1 1-335 truncation was made by site- directed mutagenesis of the SNAP-Tm1 FL plasmid using primers that inserted a stop codon after aa 335 as described above.
-
bioRxiv - Cell Biology 2023Quote: ... The cDNA for p53 WT or p53 QM was cloned together with the DNA sequence for an NH2-terminal FLAG tag into pRetroX-Tight-Pur (Clontech). Retroviruses with the vesicular stomatitis virus–G (VSV-G ...
-
bioRxiv - Biochemistry 2023Quote: Khc FL for in vitro studies was cloned with a HisSUMO-SNAP-3C-tag into MCS1 between BamHI and HindIII sites of the pFastBacDual vector by InFusion cloning (Takara). The Khc mutant constructs used for in vitro studies were generated by site-directed mutagenesis of the Khc FL plasmid using primers that either inserted a stop codon after aa 910 (Khc910 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The H2afx coding sequence from Mus musculus was ordered from Eurofins and cloned into the pOZ-N-FH backbone adding the 1xHA tag at the N terminus using the in-fusion HD cloning kit (#12141, Takara). Full length wild type H2afx coding sequence was then mutagenized to obtain the desired S139A point mutation.
-
bioRxiv - Microbiology 2023Quote: ... and cloning it into the EcoRI and EcoRV sites of pcDNA-EGFP-P2A in frame with the tag sequence by using an In-Fusion® HD Cloning Kit according to the manufacturer’s instructions (Takara). pcDNA-hAPOBEC1 was constructed by cloning the XhoI-HindIII fragments of pUC57-APOBEC1 ...
-
bioRxiv - Developmental Biology 2023Quote: ... G9 deletion mutants were generated by PCR amplification or overlap extension PCR and inserted in frame with the MYC tag into the pCS2-MT-NLS expressing vector using the In Fusion Protocol (ST0345, Takara). All constructs were confirmed by Sanger sequencing.
-
bioRxiv - Cancer Biology 2024Quote: ... were subcloned and fused with the CD8 signal peptide sequence (MALPVTALLLPLALLLHAA) followed by a Myc-tag at the N-terminus in pIRESpuro3 (Clontech). Humanized EREG mAbs H231 and H206 (23 ...