Labshake search
Citations for Takara Bio :
51 - 100 of 5977 citations for Thyroxine T4 ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 1 × 106 PBMCs were plated on retronectin coated 6-well plates (Takara Clonetech) with retroviral vectors and centrifuged at 1,000 × g for 40 min ...
-
bioRxiv - Biochemistry 2021Quote: ... T4 polynucleotide kinase and TransIT®-LT1 Reagent were purchased from TAKARA (Shiga, Japan). SB203580 was purchased from Adipogen Life Science (San Diego ...
-
bioRxiv - Genetics 2020Quote: ... A 3′-dephosphorylation and 5′-phosphorylation reaction was performed using T4 PNK enzyme (TaKaRa). The enzyme was removed by phenol-chloroform purification ...
-
bioRxiv - Molecular Biology 2023Quote: ... and then cloned into the pUC57-SmD vector by using T4 DNA ligase (Takara). The pUC57-SmD-108 constructs were employed to evaluate the correlation of protein folding stability with TMP resistance in our selection system.
-
bioRxiv - Microbiology 2024Quote: ... DNA adapters were ligated to MmeI-digested DNA fragments by T4 DNA ligase (Takara), and the ligation products were purified on magnetic beads ...
-
bioRxiv - Cancer Biology 2023Quote: ... 150,000 cells were seeded in 6-well plates 1 day before transfection with 1 μg pp53-TA-Luc vector (Clontech) and 0.015 μg pRL-CMV-Renilla (Promega ...
-
bioRxiv - Molecular Biology 2020Quote: ... They were radiolabeled at their 5′ ends with [γ-32P] ATP by T4 polynucleotide (Takara) and purified using Oligo Clean & Concentrator (Zymo Research ...
-
bioRxiv - Plant Biology 2023Quote: ... Digested DNA was ligated to adapters with T4 DNA ligase (Takara Bio Inc., Shiga, Japan) and purified with Agencourt AMPure XP cleanup reagent (Beckman Coulter ...
-
bioRxiv - Cell Biology 2023Quote: ... and the 5′-end was phosphorylated with T4 polynucleotide kinase (Cat. # 2021S: Takara, Kyoto, Japan). This phosphorylated DNA fragment was ligated to the Bbs I cloning site in pSpCas9(BB)-2A-Puro (PX459 ...
-
bioRxiv - Bioengineering 2023Quote: ... The extracted DNA was further treated with T4 DNA polymerase (Takara Bio Inc., Otsu, Japan) for DNA blunting ...
-
bioRxiv - Cell Biology 2022Quote: cDNA was generated from single cells in the 96-well plate using the SmartSeq v4 kits (Takara Bio) using 1/4th volume reactions dispensed using a Mantis dispenser (Formulatrix) ...
-
bioRxiv - Microbiology 2021Quote: ... An anti-histidine antibody was used for ELISAs as positive control (Takara, catalog # 631212).
-
bioRxiv - Molecular Biology 2020Quote: ... and further ligated into BbsI digested pX330 plasmids by T4 DNA ligase (Takara; Kusatsu, Shiga, Japan). The ligate was transformed to DH5α competent cells for culture overnight ...
-
bioRxiv - Molecular Biology 2020Quote: ... Antisense probes were radiolabeled at their 5′ ends with [γ-32P] ATP by T4 polynucleotide (Takara) and purified using Performa Spin Columns (Edge BioSystems) ...
-
bioRxiv - Microbiology 2023Quote: ... corresponding to these sgRNA sequences (LpAsp_For and LpAsp_Rev as well as LpCht_For and LpCht_Rev) were phosphorylated by T4 polynucleotide kinase (TAKARA) followed by annealing and cloning into BbsI digested pSPneogRNAH vector (Zhang and Matlashewski ...
-
bioRxiv - Genetics 2021Quote: ... prepare non-tissue culture treated plates by adding RetroNectin (1 μg/μL; Takara Bio, Otsu, Japan) to enhance transduction efficiency ...
-
bioRxiv - Molecular Biology 2021Quote: 20 cm plates of HEK293T cells were transfected with 10 µg of each plasmid using CalPhos transfection kit (Takara) according to manufacturer’s instructions and harvested 3 days later ...
-
bioRxiv - Genetics 2022Quote: ... then combined with 6 µL cDNA and 15 µL Mighty Mix T4 DNA ligase reaction mix (Takara) and incubated overnight at 16 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... An oligonucleotide probe against snoRNA58 labeled with [γ-32P] ATP by T4 polynucleotide kinase (Takara, cat# 2021A) was used as a loading control ...
-
bioRxiv - Microbiology 2022Quote: ... The plasmids were extracted from all the colonies which grew on QDO/X/A agar plate using Easy Yeast Plasmid Isolation Kit (TaKaRa). PCR was carried out using the extracted plasmids as template ...
-
bioRxiv - Cell Biology 2021Quote: Transfection of Halo-tagged AnkB440 plasmids were conducted in HEK293T cells grown in 10 cm culture plates using the calcium phosphate transfection kit (Takara) and 8 µg of plasmid ...
-
bioRxiv - Immunology 2023Quote: ... into 96-well plates containing 12.5μl CDS sorting buffer as described in the SMART-Seq® HT Kit protocol (Takara Bio). Full-length cDNA amplification of single cells was performed per the kit protocol (Takara Bio) ...
-
bioRxiv - Cancer Biology 2023Quote: ... non-adherent plate (Takara Bio). Cells were grown for 14 days ...
-
bioRxiv - Plant Biology 2020Quote: ... Total RNA was isolated from seedlings and ligated to the 5’ RNA adaptor by T4 RNA ligase (TaKaRa). Reverse transcription was performed with 9-nt random primers and the cDNA amplified by PCR with an adaptor primer and a gene-specific primer ...
-
bioRxiv - Cell Biology 2023Quote: ... the single-stranded DNA (5’-AATTCAAAGAATTAACCTTAATTGAA GGGGAGGGTTCAGTACTTTTGTGTAGTACAAATATCAGTACTTTTGTGTAGTACAAAA GGGAGGGCTTCAATTAAGGTTAATTCTTTG-3’) was treated with T4 DNA ligase (Takara, Beijing, China) after annealing ...
-
bioRxiv - Immunology 2023Quote: Non-tissue culture treated 12-well plates were coated overnight at 4°C with 1 ml Retronectin (Takara) at 25 μg/ml in PBS ...
-
bioRxiv - Cell Biology 2022Quote: Cells cultured in either 12- or 24-well plates were washed twice with cold PBS and harvested using a TaKaRa MiniBEST universal RNA extraction kit (Takara, Japan). RNA was purified using the same kit according to the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Cells cultured in either 12 or 24-well plates were washed twice with cold PBS and harvested using TaKaRa MiniBEST Universal RNA extraction kit (Takara, Japan). RNA was purified using the same kit according to manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... Plates were coated with 5μg/mL of target peptide using coating reagent from the Takara Peptide Coating Kit (Takara cat. #MK100). Measles peptide was utilized as a negative control ...
-
bioRxiv - Cancer Biology 2023Quote: Reverse Transcriptase PCR and Real-Time PCR Cells cultured in either 12- or 24-well plates were washed twice with cold PBS and harvested using a TaKaRa MiniBEST universal RNA extraction kit (Takara, Japan). RNA was purified using the same kit according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... a WST-1 cell proliferation assay kit (MK400, Takara Bio) was used according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: Levels of p24 antigen in the purified SARS-CoV-2 pseudotype solution was measured by ELISA (Takara). Mouse sera were heat inactivated ...
-
bioRxiv - Microbiology 2020Quote: ... and a U2 adapter was ligated to each dsRNA fragment using T4 RNA ligase (Takara Bio Inc., Kusatsu, Japan). After denaturing the product ...
-
bioRxiv - Molecular Biology 2020Quote: ... at 50°C for 1hr followed by incubation with 0.5U/μL T4 RNase H at 37°C.The libraries were generated by PCR using LA Takara taq polymerase (Clontech) and oligos P5 and PE (see Table S1 ...
-
bioRxiv - Genomics 2021Quote: ... Non-tissue culture treated 12-well plates were prepared by incubating 1 mL PBS + 25 μg/mL Retronectin (Takara) overnight at 4°C ...
-
bioRxiv - Immunology 2020Quote: ... non-tissue culture treated 96-well plates were coated overnight at 4 °C with 1 ml of retronectin (Takara) at 25μg/ml in PBS ...
-
bioRxiv - Developmental Biology 2019Quote: ... Annealed oligonucleotides were ligated into pGP-U6 (GenePharma, Shanghai, China) between the Bbs and Xho sites by T4 DNA ligase (TaKaRa) to produce pGP-U6-Mis-shRNA ...
-
bioRxiv - Plant Biology 2022Quote: ... The gRNAs used in this study were synthesized and inserted at BsaI site of pDC expressing vectors using T4 ligase (2011A, Takara). For dual sgRNA system ...
-
bioRxiv - Microbiology 2023Quote: ... inverse PCR amplification was conducted with oligonucleotides and templates listed in Table S1 and the resulting PCR products were treated with T4 Polynucleotide Kinase (Takara) and ligated with a DNA ligation kit (Takara) ...
-
bioRxiv - Evolutionary Biology 2023Quote: The PCR products (3.2 kb or 2.0 kb of HBV-DNA if the 3.2-kb DNA was unavailable) were cloned into the vector PMD-19T with T4 DNA Ligase (Takara, Japan) and transformed into TOP10 Escherichia coli competent cells (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... synthesized 5’ and 3’ fragments of the target RNA were 32P-radiolabeled at the 5’ end using T4 polynucleotide kinase (Takara). After gel purification ...
-
bioRxiv - Plant Biology 2023Quote: ... between the pU6 promoter and sgRNA scaffold via Bsa I digestion and T4 DNA ligase-mediated ligation (Takara, cat. 6023). For oligonucleotide-dependent mutation knock-in ...
-
bioRxiv - Genomics 2019Quote: ... 1-mM SMARTer Kit dNTP Mix (10 mM each; Clontech, 634936), 1.2-μM SMARTer Kit SMARTer II A Oligonucleotide (12 μM ...
-
bioRxiv - Systems Biology 2022Quote: Following the transfer of samples into a 384-well plate containing RT-PCR buffer with 3’ SMART-Seq CDS Primer IIA (SMART-Seq® v4 PLUS Kit, TaKaRa, cat# R400753); the samples were immediately denatured at 72ºC for 3 min and chilled on ice for at least 2 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... were co-transfected into HEK293T cells at a 1:1:1:1.6:4.6 ratio using CalPhos mammalian transfection kit (TaKaRa Clontech, Mountain View, CA #631312) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... 2013) In which, once double digestion with MboI and MseI enzymes (Fermentas, Lithuania) and ligation by T4 DNA ligase (Takara Bio), PCRs by limited adaptors and primers were conducted (all used adaptors and PCR primers listed in Table S4).
-
bioRxiv - Microbiology 2020Quote: ... Construction of strains with cytoplasmic sGFP expression was performed by cloning the sGFP expression cassette from plasmid pIGPAPA and the neo cassette from plasmid pSD1 to the polylinker of plasmid pBluescript II (using the T4 DNA ligase, Takara Bio). The resulting plasmid pBS-GFP-gen was used to transform V ...
-
bioRxiv - Microbiology 2022Quote: ... the 3′ terminus of each strand of dsRNA was ligated with PC3-T7loop oligo (Table S1) using T4 RNA ligase (TaKaRa, China) at 16 °C for 16 h ...
-
bioRxiv - Genomics 2019Quote: ... 1-U/μL SMARTer Kit RNase Inhibitor (40 U/μL; Clontech, 634936), 10-U/μL SMARTScribe™ Reverse Transcriptase (100 U/μL ...
-
bioRxiv - Molecular Biology 2021Quote: ... were co-transfected into HEK293T cells at a 1:1:1:1.6:4.6 ratio using CalPhos mammalian transfection kit (TaKaRa Clontech, Mountain View, CA #631312) according to manufacturer’s instructions ...