Labshake search
Citations for Takara Bio :
501 - 550 of 1148 citations for Testosterone 100 Ug Ml In Methylene Chloride 3 4 13C2 99%; 17 18O 98% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2021Quote: ... The template plasmid for the mCherry-targeting ssDNA was constructed with 1.5 kb long 5’ and 3’ arms amplified from the C57BL/6N genome using PrimeSTAR GXL DNA Polymerase (TaKaRa), the upstream genome sequence of the stop codon of Rtl5 and downstream of the predictive cut site by Cas9 ...
-
bioRxiv - Microbiology 2020Quote: 5’-RACE analysis was performed using SMARTer RACE 5’/3’ kit and In-Fusion HD Cloning kit according to the manufacturer’s instructions with slight modifications (Clontech). 5’-RACE ready cDNA was synthesized from purified mRNA (TG ...
-
bioRxiv - Immunology 2021Quote: ... Cells were harvested after 3 d and AAV6 was purified with a filtration-based kit (Takara AAVpro Purification Kit) per the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... then imaged after overnight expression and ∼3 hour incubation with 500 nM A/C heterodimerizer linker drug (Takara, 635055) or 100% ethanol ...
-
bioRxiv - Immunology 2022Quote: ... Recombinant adenovirus vaccines were produced using the Adeno-X™ Adenoviral System 3 according to the manufacturer’s manual (Takara Korea Biomedical Inc. ...
-
bioRxiv - Microbiology 2022Quote: ... and the 3’ flanking region) and the linearized pHIS906 were fused using the In-Fusion enzyme (TAKARA, Shiga, Japan) to create the pHIS3-AWP1 plasmid ...
-
Retrovirus-derived RTL9 plays an important role in innate antifungal immunity in the eutherian brainbioRxiv - Evolutionary Biology 2023Quote: ... The plasmid for mCherry insertion was constructed with 1.5 kb long 5’ and 3’ arms amplified from the C57BL/6N genome using PrimeSTAR GXL DNA Polymerase (TaKaRa). The 5’ arm is the genomic sequence upstream of the stop codon of Rtl9 and the 3’ arm is downstream of the predictive Cas9 cut site ...
-
bioRxiv - Cancer Biology 2023Quote: ... Reverse transcription of mRNA was performed using 3-5 μg RNA with RNA to cDNA EcoDry Premix (Takara, #639549). For real-time PCR analysis ...
-
bioRxiv - Plant Biology 2023Quote: ... and SD4 (-Trp-Leu-His-Ade) media at 30℃ for 3–5 d according to the manufacturer’s manual (Clontech).
-
bioRxiv - Genomics 2024Quote: ... Supernatant containing viral particles was harvested after 2 and 3 days and concentrated 100x using Lenti-X concentrator (Takara) following manufacturers instructions.
-
bioRxiv - Cell Biology 2024Quote: ... filtered through a 0.45 µm polyethersulfone filter and used directly or concentrated 3-fold with Lenti-X Concentrator (Clontech).
-
bioRxiv - Neuroscience 2024Quote: ... AAV was purified 3–5 days after transfection using AAVpro Purification Kit Midi or Maxi (Takara Bio, Shiga, Japan). The viral concentration was measured by qRT-PCR.
-
bioRxiv - Developmental Biology 2021Quote: ... The final BAC was purified with Nucleobond BAC 100 Kit (Takara Bio, cat no. 740579) and co-injected with 1 nl of 40 ng/ul tol2 mRNA into one-cell stage embryos ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing 2 μL of lysis buffer (0.2% Triton X-100, 4U of RNase inhibitor, Takara) per well ...
-
bioRxiv - Biochemistry 2022Quote: ... DNA-lipid complexes were prepared by incubating 100 ng of eGFP-N1 plasmid (Takara Biosciences) with Lipofectamine 2000 for 20 min ...
-
bioRxiv - Genomics 2021Quote: ... These cells were cultured using Cellartis DEF-CS 100 Culture System (DEF-CS medium; Takara) under feeder-free condition ...
-
bioRxiv - Genomics 2021Quote: Genotyping PCR were performed using 100 ng of gDNA and LA Taq DNA polymerase (Takara), with the following cycling conditions ...
-
bioRxiv - Microbiology 2022Quote: ... the supernatants were mixed with 100 μl of the Talon metal affinity resin (Clontech, USA) in a 1.5-ml tube ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The decanted soluble extract was adjusted to a volume of 90 mL with lysis buffer and incubated with 10 mL TALON cobalt resin (Takara, Shiga, Japan) for 1 h at 4°C ...
-
bioRxiv - Cancer Biology 2023Quote: BON1/HA-Bcl-xL/TR-shCtBP2 and BON1/HA-Bcl-xL/TR-shRLuc #713 cells were treated with 1 µg/ml (before sorting) or 0.5 µg/ml (after sorting) doxycycline (Clontech Laboratories, Inc., 631311) for 96 hours ...
-
bioRxiv - Developmental Biology 2020Quote: ... embryos were incubated overnight at 4°C with rabbit anti-DsRed (1:500 in BB; Clontech 101004), mouse anti-Myh6 antibody (1:200 in BB ...
-
bioRxiv - Cell Biology 2019Quote: ... The blots were incubated overnight at 4°C with a mouse anti-GFP antibody (RRID:AB_2323808, 63281, Clontech) at a 1:2,000 dilution in blocking buffer ...
-
bioRxiv - Immunology 2020Quote: ... Activated NK cells were transduced with retroviral supernatants on day +4 in human fibronectin-coated plates (Clontech Laboratories ...
-
bioRxiv - Neuroscience 2019Quote: ... Sections were incubated overnight at 4° C with anti-rabbit tdTomato (1:2000; TaKaRa, Cat# 632543, RRID:AB_2307319), anti-rabbit GFP (1:2000 ...
-
bioRxiv - Microbiology 2021Quote: ... and 20 ng of firefly luciferase (pGL) by using 4 µl of TransIT 293 (Takara, Shiga, Japan) and 140 µl of OPTI- MEM (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... The extract was incubated for 1 h at 4 °C with Talon resin (Clontech, Mountain View, CA), loaded onto a column ...
-
bioRxiv - Microbiology 2019Quote: ... The NusA tag of GfsB was cleaved with a HRV 3C protease at 4°C (Takara Bio) and removed by Ni-agarose ...
-
bioRxiv - Immunology 2023Quote: ... RNA was then amplified using SMART-Seq v.4 Ultra Low Input RNA kit (Clontech, cat. 63488). Subsequently ...
-
bioRxiv - Microbiology 2021Quote: ... 10 U ml−1 of HRV- 3C protease (Takara) were added to the Ni-NTA eluted protein to remove the oligohistidine- GST-tag during dialysis against 3 L of dialysis buffer I (25 mM Tris-HCl ...
-
bioRxiv - Neuroscience 2022Quote: ... and 2 μg/ml Doxycycline (Clontech; Cat. No. 631311). iTF-iPSCs were counted and seeded onto double coated plates (Poly-D-Lysine-precoated Bio plates (Corning ...
-
bioRxiv - Physiology 2021Quote: ... 1 mL of Fruit-mate (Takara, catalog no.: 9192) was added ...
-
bioRxiv - Microbiology 2022Quote: ... The 5 mL HisTALON cartridge (Clontech Laboratories, Cat# 635683) column was equilibrated with ten column volumes of Equilibration Buffer (HisTALON Buffer Set ...
-
bioRxiv - Neuroscience 2021Quote: ... were coated with 9ug/mL retronectin (Takara bio T110B) and incubated overnight at 4°C ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and 0.5 U/ml Bacterial Alkaline phosphatase (Takara 2120A) at 37°C for 1 h in 10 µl of a reaction mixture containing 20 mM HEPES–KOH pH 7.5(Nacalai 15639-84) ...
-
bioRxiv - Microbiology 2021Quote: ... followed by selection with 2 μg/ml puromycin (Clontech). (For the sequences of shSIRT6 ...
-
bioRxiv - Microbiology 2021Quote: ... The 5 mL HisTALON cartridge (Clontech Laboratories, Cat # 635683) column was equilibrated with 10 column volumes of Equilibration Buffer (HisTALON™ Buffer Set ...
-
bioRxiv - Immunology 2021Quote: ... culture plates were coated with RetroNectin (20μg/ml) (Takara) at 4o C ...
-
bioRxiv - Neuroscience 2023Quote: ... and 2 μg/ml doxycycline (Clontech, cat. no. 631311). Neuronal induction media was changed once a day for 2 more days ...
-
bioRxiv - Biochemistry 2023Quote: ... and 20 ml of Tractor Buffer (Cat# 63567, TAKARA), followed by 2.5U/ml of DNase I and 50 mg/ml of lysozyme were added and incubated for 10 min at 25°C ...
-
bioRxiv - Neuroscience 2023Quote: ... and 2 μg/ml doxycycline (Clontech, cat. no. 631311). Neuronal induction media was changed once a day for 2 more days ...
-
bioRxiv - Neuroscience 2023Quote: ... with 2µg/mL doxycycline (Takara Bio, Cat. No. 631311) to induce expression of NGN2 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 3.3 mL of Lenti-X concentrator (Takara, cat.# 631231) were added to 10 mL of filtered SN ...
-
bioRxiv - Neuroscience 2023Quote: ... and 2 μg/ml doxycycline (Clontech, cat. no. 631311). Neuronal induction media was changed once a day for 2 more days ...
-
bioRxiv - Neuroscience 2024Quote: ... Protamine sulfate (Final concentration: 8 μg/ml, Takara Bio) was added ...
-
bioRxiv - Genetics 2023Quote: ... mixed with 5 mL Lenti-X Concentrator (Takara, 631232) and rocked at 4 °C overnight ...
-
bioRxiv - Cell Biology 2020Quote: ... These ligated pools were then amplified using AdR_PCR oligonucleotides as primer (5′-GGTCGCGGCCGAGGATC-3′) (IDT) and Advantage cDNA polymerase mix (Clontech, 639105). Amplicons were electrophoresed in 1% agarose gel to check for amplification and the size distribution of the library and then column purified (Qiagen ...
-
bioRxiv - Cell Biology 2020Quote: ... TTAGCTAGCCTTCTGATGTGATAGTTTATC TTCTG-3’ were used to amplify the 3xFLAG-BBS10 from the BBS10 ORF plasmid using CloneAmp HiFi PCR premix (Takara), which was further cloned into the CD520A-GFP plasmid via XbaI and Nhe I restriction sites ...
-
bioRxiv - Developmental Biology 2021Quote: ... Specific forward and reverse primers (Suppl Table 3) were designed using the In-Fusion Cloning Primer Design Tool from TaKaRa (https://www.takarabio.com/learning-centers/cloning/primer-design-and-other-tools ...
-
bioRxiv - Developmental Biology 2021Quote: ... The resulting plasmids were co-transformed into Saccharomyces cerevisiae strain AH109 according to the protocols in the Matchmaker GAL4 Two-Hybrid System 3 (Clontech). The yeast cells were cultured on SD/-Leu-Trp (-LW ...
-
bioRxiv - Molecular Biology 2021Quote: ... reverse transcription of the RNA using a primer designed to the constant region of the barcoded adaptor with addition of an adapter to the 3’ end of the cDNA by template switching using SMARTScribe (Clontech) as described [18] (ii ...