Labshake search
Citations for Takara Bio :
201 - 250 of 1086 citations for TRAILR 2 TNFRSF10B Human HEK 293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... the pLVX-ORF3-E plasmid was transfected into HEK-293T cells using the Lenti-X Packaging Single Shots kit (Takara). Lentiviral supernatants were harvested at 72 h post-transfection and filtered through a 0.22 μM membrane (Millipore ...
-
bioRxiv - Microbiology 2021Quote: ... retroviral packaging construct pTG5349 and a reporter pCCLSIN.cPPT.hPGK.GFP.WPRE into HEK 293T cells by calcium-phosphate method (Calphos Mammalian Transfection kit, Clontech as per manufacturer’s instructions). Cells were seeded on 60×15mm dish a day before transfection to achieve 70 – 80% confluency ...
-
bioRxiv - Cancer Biology 2022Quote: Viral particles were generated by transfecting the lentiviral construct into HEK-293T cells using Lenti-X Packaging Single Shots (Clontech). 48 hours after transfection ...
-
bioRxiv - Cancer Biology 2023Quote: ... Additional lentiviral vectors were packaged in HEK 293T cells using Lenti-X Packaging Single Shots (VSV-G) (Takara Bio USA) per the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV1-syn-F14F15S-sTpEptTA_v2 were made by transfecting 8×15c plates (per virus) of HEK 293T cells using Xfect transfection reagent (Takara 631318). Briefly ...
-
bioRxiv - Cancer Biology 2023Quote: ... The generated lentiviral plasmids were cotransfected with viral packaging plasmids PAX2 and pMD2.G into HEK 293T Lenti-X cells (Clontech) using TransIT-LT1 (Mirus Bio LLC ...
-
bioRxiv - Immunology 2021Quote: ... The retroviral transfer vector was co-transfected with pVSV-G retroviral envelope-expressing plasmid into the GP2-293 cell line (Clontech-TaKaRa) using Lipofectamine 2000 reagent (Invitrogen ...
-
bioRxiv - Immunology 2022Quote: ... Retroviral vectors were packaged into VSV G–pseudotyped murine leukemia virus (MLV) particles by co-transfecting GP2-293 cells (Clontech Laboratories) with pQCXIP constructs and pVSV-G (Clontech Laboratories) ...
-
bioRxiv - Cell Biology 2023Quote: ... the transfer plasmid (pBABEpuro-based or pLZRS-IRES-ΔNGFR/GFP-based) and pCMV-VSV-G were co-transfected into GP2-293 packaging cells using CalPhos mammalian transfection kit (Takara/Clontech) according to manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2024Quote: AAV-vector plasmid and AAV-crTSG were used for AAV9 production and purification using Lenti-X 293 T cells (Takara Bio). Each set of Lenti-X 293 T cells (6 150mm-plates ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Cell Biology 2021Quote: The cDNA encoding human BORCS6 was cloned from human lung total RNA (Takara Bio, Japan) and inserted into pCR4-TOPO (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: Human MPS1 and NSL1 were amplified from Human testis cDNA (Marathon cDNA; Takara Bio Inc.) using Pfu polymerase (Promega) ...
-
bioRxiv - Neuroscience 2021Quote: ... coated T-225 flasks containing 85-95% confluent HEK-293T/17 cells (ATCC, CRL-11268) were each transfected (Xfect, Takara #631318) with a DNA cocktail containing the 1 ...
-
bioRxiv - Neuroscience 2023Quote: ... Supernatants from rescue plates were passaged on 15 cm plates of HEK 293T/17 cells (ATCC) transfected with pLV-TTBG and pLV-TTBL (described above) using Xfect transfection reagent (Takara 631318) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: Plasmids NLAD8 HIV-1 AD8 Macrophage-Tropic R5 (NIH AIDS reagents #11346) or HIV Gag-imCherry V3 loop (29) were transfected in HEK 293T cells using CalPhos Mammalian Transfection Kit (Takara Bio) in DMEM ...
-
bioRxiv - Biophysics 2019Quote: ... Cells were harvested and purified using TALON His-Tag Purification protocol (Clontech Laboratories, Mountain View, CA.) The SUMO tag was cleaved by Ulp-1 as described above and the protein was further purified using ion-exchange chromatography (Bio-Rad ...
-
bioRxiv - Plant Biology 2020Quote: ... and on a SD-Leu-Trp-Ade-His plate containing X-α-gal (Takara Bio, USA). Plates were imaged after incubation for 60 - 72 hr at 30°C unless otherwise stated ...
-
bioRxiv - Plant Biology 2020Quote: ... The E.coli-expressed tNPR1-His protein was extracted and purified using TALON Metal Affinity Resin (Clontech). For rabbit immunization ...
-
bioRxiv - Genetics 2022Quote: ... then washed in water and re-suspended in 125-250mL -leu - his galactose liquid culture (Takara Bio Minimal SD Bases ...
-
bioRxiv - Molecular Biology 2019Quote: ... the fragment were ligated into the Xho I and Bam HI sites of pEGFP-N3 (Clontech), creating Aβ fused in frame to the N-terminus of GFP ...
-
bioRxiv - Neuroscience 2023Quote: ... pAcGFP-His-MAP2C without AcGFP was amplified and Dendra2 was amplified from pDendra2-C vector (Takara). Dendra2 was inserted into where AcGFP was by In-Fusion cloning kit ...
-
bioRxiv - Cell Biology 2023Quote: ... His-tagged recombinant proteins were isolated by 1 h incubation with Talon metal affinity resin (Clontech) at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... HEK293T cells grown in 10 ml of medium (3.0 x 105 cells/ml) were transfected with 10 µg of pCAGGS-NP (1-450) using TransIT-293 Reagent (Takara, Shiga, Japan). Three days post-transfection ...
-
bioRxiv - Neuroscience 2019Quote: ... and human WT hP-NPO cDNA was amplified from human brain cDNA library (TaKaRa, Cat #637242) with primers ...
-
bioRxiv - Cell Biology 2021Quote: ... The nucleotide sequence encoding for human CyPD was obtained from a Human cDNA placenta library (Clontech) by PCR ...
-
bioRxiv - Microbiology 2020Quote: Human embryonic kidney 293T (Clontech, 632180), human lung carcinoma A549 (ATCC ...
-
bioRxiv - Microbiology 2023Quote: ... packaging cells were transfected with expression vectors (pMSCVneo-fePit1, pMSCVneo-fePit2, or pMSCVneo empty vector) using the TransIT®-293 reagent (Takara, Kusatsu, Japan). Two days later ...
-
bioRxiv - Plant Biology 2019Quote: Each purified protein preparation of His-PHOT1 N2 and N4 was incubated with TALON Magnetic Beads (TaKaRa) at 4°C for 30 min and further incubated at 4°C for 30 min with in vitro transcription and translation reactant containing RPT2 N ...
-
bioRxiv - Cell Biology 2022Quote: ... The library was generated by using the SMARTer Stranded Total RNA Sample Prep Kit - HI Mammalian (Clontech) with 1 μg RNA as input ...
-
bioRxiv - Microbiology 2020Quote: ... the His-tagged spike protein produced in the culture supernatants was purified with a Talon resin (Clontech).
-
bioRxiv - Pathology 2020Quote: ... RBD-scFv was purified from the supernatant using Capturem™ His-Tagged Purification Miniprep Kit (Takara Bio). One prep of 800 μL supernatant through one column of the kit yielded 102 μg/mL of RBD-scFv measured by NanoDrop™ 2000/2000c Spectrophotometers (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Fractions were precipitated with trichloroacetic acid (TCA) and subjected to Western blot analysis (anti-His antibody, Clontech). Additionally ...
-
bioRxiv - Developmental Biology 2020Quote: ... Both chicken DLX1 and DLX1 Q50E proteins were purified using Capturem His-Tagged Purification Maxiprep Kit (Clontech), and verified by Western blot with primary antibodies against 6x His tag (Invitrogen ...
-
bioRxiv - Bioengineering 2023Quote: ... Yeast transformants were selected by growth on synthetic dropout nutrient medium SD/-Leu/-His/-Ade/-Trp (Clontech) supplemented with 40mg/LX-α-gal (5-bromo-4-chloro-3-indolyl-a-D-galactopyranoside ...
-
bioRxiv - Bioengineering 2021Quote: ... Human umbilical vein endothelial cells (HUVECs) and human aortic smooth muscle cells (HAoSMCs) were purchased from TAKARA BIO (Tokyo ...
-
bioRxiv - Developmental Biology 2021Quote: ... Lentiviral supernatants were subsequently collected after transfection of HEK 293T cells with either the pLVX-TRE3G-GOI or the pLVX-Tet3G vector using the X-fect reagent (Clontech; Cat. No. 631317). Supernatants were concentrated by ultracentrifugation ...
-
bioRxiv - Bioengineering 2023Quote: ... CCR5-KO donor rAAV6 virus was produced in HEK-293T cells and was purified with AAVpro Purification Kit (TakaRa, San Jose, CA, USA). Electroporation of the RNP complex was performed using the Lonza 4D-Nucleofector (Lonza Group Ltd ...
-
bioRxiv - Cancer Biology 2023Quote: Lentiviral particles were generated in HEK 293T cells by co-transfection of the lentiviral vector pLVX-luc-IRES-puro (Clontech, Mountain View, CA) with the pCMV-dR8.9 and pCMV-VSV-G plasmids (both obtained from Addgene ...
-
bioRxiv - Neuroscience 2019Quote: ... test genes (vascular connexins) in human vessels were normalized relative to human whole heart (RNA purchased from Clontech) and in mouse ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA of Human Phosphodiesterase type 10 (hPDE10) was amplified by conventional nested PCR using human brain cDNA (Clontech). cDNAs template encoding wild-type and D674A mutant form of hPDE10 catalytic domain (CD ...
-
bioRxiv - Developmental Biology 2024Quote: ... Human full-coding KATNA1 cDNA was isolated from a human fetal brain Marathon-ready cDNA collection (Clontech, Invitrogen) with the following forward and reverse primers ...
-
bioRxiv - Plant Biology 2022Quote: ... and His (-HTLA) but containing 5-bromo-4-chloro-3-indolyl α-D-galactopyranoside (Clontech, Madison, WI, USA). As a control ...
-
bioRxiv - Microbiology 2022Quote: ... then the His-tagged ORF8 protein produced in the culture supernatants was purified with a Talon resin (Clontech). The absence of endotoxin contamination was confirmed using the ToxinSensor chromogenic LAL Endotoxin Assay Kit (GeneScript).
-
bioRxiv - Molecular Biology 2023Quote: ... and RNA-sequencing libraries were made using the SMARTer Stranded Total RNA Sample Prep Kit - HI Mammalian (Takara). Libraries were sequenced at the Bauer Core Facility (Harvard University ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA-seq libraries were prepared with the SMARTer Stranded Total RNA Sample Prep Kit - HI Mammalian (Takara #634875). 75 bp single-end sequencing was performed using an Illumina NextSeq500 system at the CRI at UT Southwestern Sequencing Facility ...
-
bioRxiv - Plant Biology 2023Quote: ... Ade and His but containing 5-Bromo-4-Chloro-3-indolyl a-D-galactopyranoside (X-a-gal) (Clontech). To detect interactions ...
-
bioRxiv - Genomics 2023Quote: ... Libraries were prepared using the SMARTer Stranded Total RNA Sample Prep Kit - HI Mammalian (Takara Bio USA, Inc.), which incorporates both RiboGone and SMART (Switching Mechanism At 5’ end of RNA Template ...
-
bioRxiv - Genomics 2023Quote: ... 100 ng to 1 µg of total RNA was used for Hi-Mammalian whole transcriptome preparation (Takara Bio) and sequencing was performed on Nextseq2000 instrument with 1 x 72 bp single-end setup ...
-
bioRxiv - Microbiology 2023Quote: ... The His-tagged CRONE protein was purified by cobalt affinity chromatography using TALON® metal affinity resin (Takara) under native conditions in phosphate buffered saline (PBS) ...