Labshake search
Citations for Takara Bio :
301 - 350 of 5266 citations for TBARS MDA Universal Colorimetric Detection Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... cDNA was prepared from 2 µg of each RNA sample using the PrimeScript II 1st strand cDNA synthesis kit (TaKaRa, Shiga, Japan) with 40 units of RNasin Plus RNase inhibitor (Promega ...
-
bioRxiv - Genetics 2020Quote: ... First-round reverse transcription PCR (RT-PCR) was conducted by using PrimeScript One Step RT-PCR Kit Ver.2 (TaKaRa, Dalian, China). A 10 μL reaction mixture contained 5 μL of 2 × 1 Step Buffer ...
-
bioRxiv - Immunology 2021Quote: Retroviral SARS-CoV-2 Spike pseudovirus were generated in 293T cells by co-transfecting expression plasmids containing SARS-CoV-2 Spike and MLV gag/pol and luciferase vectors using Calphos transfection kit (Takara Bio, USA) as described [20] ...
-
bioRxiv - Cancer Biology 2022Quote: ... For reverse transcription 2 µg RNA were translated into cDNA using the “RNA to cDNA EcoDry” Kit (Takara Bio USA, Kusatsu, Japan) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... and amplified by PCR using a forward primer containing a T7 promoter sequence (Supplemental Table 10) with the Advantage HF 2 kit (Takara Bio 639124) and the following cycling conditions ...
-
bioRxiv - Cell Biology 2023Quote: ... A total of 1-2 μg RNA was reverse transcribed with random hexamers using PrimeScript 1st strand cDNA synthesis kit (Takara Bio, Japan) per the manufacturer’s protocol on Verti 96 well thermocycler (Thermo Scientific ...
-
bioRxiv - Genetics 2023Quote: ... RNA from 2 retinae of a mouse was extracted using the NucleoSpin® RNA kits (Takara Bio USA, Inc., San Jose, CA). RNA sample concentration and quality was determined with NanoDrop Oneᶜ Microvolume UV-Vis Spectrophotometers (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... cDNA library was generated from 2 nanograms of total RNA using Smart-Seq V4 Ultra Low Input RNA Kit (Takara catalog#: 634894). 150 picograms of cDNA was used to make sequencing libraries by Nextera XT DNA Sample Preparation Kit (Illumina catalog# ...
-
bioRxiv - Bioengineering 2021Quote: ... and 24 well plates coated with Retronectin (Takara # T100B) were incubated with concentrated viruses according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2019Quote: ... a 12-well plate was coated with RetroNectin (Takara). The following day ...
-
bioRxiv - Immunology 2021Quote: ... culture plates were coated with RetroNectin (20μg/ml) (Takara) at 4o C ...
-
bioRxiv - Cell Biology 2022Quote: ... on agar plates containing indicated concentration of AureobasidinA (Clontech), Calcofluor White (Sigma-Aldrich ...
-
bioRxiv - Genetics 2022Quote: ... on RetroNectin-coated plates (10 μg/cm2, Takara Bio) for at least 2 h ...
-
bioRxiv - Genetics 2022Quote: ... on RetroNectin-coated plates (10 μg/cm2, Takara Bio). Cells were then transduced in the same medium ...
-
bioRxiv - Neuroscience 2022Quote: ... Doxycycline (2 mg/L, Clontech) was also included on d0 to induce TetO gene expression by binding to rtTA and the TetO promoter upstream of the Ngn2 gene ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 µg/ml doxycycline (Takara) was added on day 0 to induce TetO gene expression ...
-
bioRxiv - Cell Biology 2024Quote: ... Ver.2 (Takara, cat# 6233), as per manufacturer’s protocol.
-
bioRxiv - Microbiology 2021Quote: ... Cells were originally obtained from ATCC and routinely tested negative for mycoplasma contamination (PCR Mycoplasma Detection Set, Takara).
-
bioRxiv - Molecular Biology 2022Quote: ... RT-qPCR for mRNA detection was performed with the SYBR Premix Ex Taq II (Takara Biomedical Technology, China) using Bio-Rad iQ5 detection instrument (Bio-Rad ...
-
bioRxiv - Neuroscience 2023Quote: ... All cell lines were tested for mycoplasma contamination regularly with PCR Mycoplasma Detection Set (TaKaRa, Cat. no. 6601) and maintained under passage 20 ...
-
bioRxiv - Plant Biology 2021Quote: ... Reverse transcription was then carried out using total RNA and oligo-dT primers to synthesize the first strand cDNA using the PrimeScript One-Step RT-PCR Kit (Ver.2, Takara Biotechnology, Dalian, China) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... the 5×PrimeSTAR® Buffer (Mg2+ plus) in the kit was replaced with the 2 × PrimeSTAR® GC Buffer (Mg2+ plus) (Takara, Japan). The first PCR program was as follows ...
-
bioRxiv - Molecular Biology 2023Quote: ... was performed by quantitative real-time polymerase chain reaction (PCR) using the AAVpro™ Titration Kit (for Real Time PCR) Ver.2 (Takara Bio Inc), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... fragments #1 and #2 were inserted into the PB-EF1-MCS-IRES-Neo vector using the In-Fusion HD Cloning Kit (639648; Takara Bio Inc. Kusatsu, Japan). This resulted in the PB-EF1-MCS-IRES-Zeo vector ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Developmental Biology 2021Quote: ... RT-qPCR was performed on three biological replicates using an ABI StepOne PCR detection system with SYBR Green (Takara). GmUbiquitin (SUBI-2.2 ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were originally obtained from the ATCC and routinely tested negative for mycoplasma contamination (PCR Mycoplasma Detection Set, Takara).
-
bioRxiv - Cell Biology 2022Quote: ... 6-well plates of 70% confluent Lenti-X 293T(Clontech) cells were transfected with 1.5 μg of transfer vector ...
-
bioRxiv - Immunology 2019Quote: ... before transferred to Retronectin pre-coated plate (50ug/ml; Clontech). Lentivirus encoding gRNA or scramble control were added to the cells and spun down at 2000rpm for 20min ...
-
bioRxiv - Plant Biology 2020Quote: The Arabidopsis Mate and Plate Library were used (Clontech, 630487). Full-length protein for βC1 was cloned into the pGBT9 vector to generate BD-βC1 construct ...
-
bioRxiv - Immunology 2023Quote: ... TSC were transduced by spinoculation on retronectin-coated plate (Takara) with 1:1 mixture of culture medium and retroviral supernatant ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 (TaKaRa bio. Inc., Shiga, Japan). The vector was transformed into XL1-Blue Escherichia coli competent cells (GMbiolab Co. ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 (Dye Plus; TaKaRa, Dalian, Japan), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Lenti-X concentrator (PT4421-2, Clontech) was mixed at the ratio of 1:3 and incubated at 4 °C for a short time ...
-
bioRxiv - Cell Biology 2021Quote: ... and doxycycline (2 mg/ml, Clontech). After 6 hours ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 mM DTT (Takara Bio, #639537), 1 mM dNTPs (Takara Bio ...
-
bioRxiv - Cell Biology 2021Quote: ... containing doxycycline (2 mg/ml, Clontech). We kept the cells in this medium for 5 days ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 Units of Exonuclease III (Takara) were added to 1ug of NCPs in ExoIII digestion buffer (50 mM Tris– HCl (pH 8.0) ...
-
bioRxiv - Bioengineering 2023Quote: ... 2 µg pantropic pVSV-G (Clontech), 3 µg pCL- (Imgenex) ...
-
bioRxiv - Immunology 2023Quote: ... 2 µL 100 µM DTT (Takara), 2 µL 10 µM template switching oligo ...
-
bioRxiv - Immunology 2023Quote: ... version 2 (Takara cat. no. 634411) and mRRBS library preparation was performed using custom procedures previously described by our group (23 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 U recombinant inhibitor (TaKaRa) for samples containing biological inhibitor ...
-
bioRxiv - Cancer Biology 2019Quote: ... Amplification and detection of mRNA were conducted by using the Thermal Cycler Dice® Real Time System (Takara Bio, TP800), according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... Quantitative PCR (qPCR) was performed on the CFX Connect Real-Time PCR Detection System using SYBR Green PCR Master Mix (TaKaRa). Primer pairs used were listed in Supplementary (Table S2) ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 μL of the RT reaction was combined with 2.5 μL of 10X Advantage 2 buffer (Takara), 2.5 μL of 2.5 mM dNTPs (Takara) ...
-
bioRxiv - Developmental Biology 2020Quote: Yeast media and plates were prepared according to recipes from Clontech and yeasts were grown at 30°C ...
-
bioRxiv - Immunology 2020Quote: ... plates were coated with 40 μg/mL retronectin (TAKARA, # T100A/B) overnight at 4°C ...
-
bioRxiv - Bioengineering 2022Quote: ... the 96-well plate can be coated with RetroNectin® (Clontech/Takara ...
-
bioRxiv - Cell Biology 2023Quote: ... 6-well plates of 70% confluent Lenti-X 293T cells (Clontech) were transfected with 1.5 μg transfer vector ...
-
bioRxiv - Microbiology 2022Quote: ... qRT-PCR was then performed using a Bio-Rad CFX-96 PCR detection system (USA) and a SYBR Green I mixture (Takara, Beijing). The MRSA housekeeping gene gyrB was used as an internal reference for normalization of the data.