Labshake search
Citations for Takara Bio :
1 - 50 of 841 citations for Solute Carrier Family 41 Member 2 SLC41A2 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... GenTLE Precipitation Carrier (TaKaRa) with incubation at -80°C for 1 h ...
-
bioRxiv - Cell Biology 2024Quote: ... GenTLE Precipitation Carrier (Takara). These purified ribosome footprint RNAs were ligated with linker oligonucleotides containing an inner index sequence and a unique molecular identifier (UMI) ...
-
bioRxiv - Microbiology 2022Quote: ... GenTLE precipitation carrier (Takara Bio) were added to the DNA solution and pelleted by centrifugation at 12,000 × g for 15 min at 4 °C ...
-
bioRxiv - Genomics 2023Quote: ... GenTLE Precipitation Carrier (Takara, #9094) and centrifuged for 15 min at 12000 r.p.m ...
-
bioRxiv - Microbiology 2021Quote: ... GenTLE precipitation carrier (Takara BIO, Tokyo, Japan). The concentration and purity of the DNA were measured with a DS-11FX+ Spectro/Fluorometer (DeNovix ...
-
bioRxiv - Biophysics 2022Quote: ... YeastMaker DNA carrier 50 μg (Takara Bio), supplemented with 1 μg of pYeDP60 vector) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 50 μg of denatured Yeastmaker™ Carrier DNA (Clontech). The cells were incubated with PEG4000 buffer (40% [w/v] PEG4000 ...
-
bioRxiv - Genomics 2023Quote: ... 4 µl of Dr.GenTLE precipitation carrier (Takara, cat. no. 9094) and 4 µl sodium acetate ...
-
bioRxiv - Biochemistry 2020Quote: ... and the PCR products recovered were connected with pMD-19T carrier(Takara, Janpan), then converted to DH5 alpha receptive cells (Vazyme ...
-
bioRxiv - Immunology 2023Quote: ... SMART MMLV reverse transcriptase (639524) and carrier DNA (630440) were purchased from Clontech, Takara Bio ...
-
bioRxiv - Biochemistry 2020Quote: ... Rpn11-TBHA was modified from Rpn11-HTBH (41) in the retroviral vector pQCXIP (Clontech). The TBHA tag consists of a biotinylation sequence (“B”) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 μL of Yeastmaker Carrier DNA (10 mg/mL, #630440, Takara Bio, Kusatsu, Japan), 1 μL of genome-editing plasmid (200–600 ng) ...
-
bioRxiv - Neuroscience 2021Quote: The 5’UTR promoter region of mouse L1Spa belonging to LINE-1 Tf family was amplified with the primers (Fw; AATGGGCAGAGCTCGTTTAG, Rv: CTGGTAATCTCTGGAGTTAG) and Takara LA Taq polymerase with GC buffer (Takara Bio) using pTN201 plasmid (a kind gift from Dr ...
-
bioRxiv - Microbiology 2019Quote: ... Each fragment was cloned into SmaI-digested temperature-sensitive vector pTH18ks1 (41) in Escherichia coli DH5α (Takara Bio Inc.).
-
bioRxiv - Microbiology 2019Quote: ... 41). The retroviral vector LHSXN (a gift from T. Zang and P. Bieniasz) is a derivative of LHCX (Clontech) modified to contain the following MCS 5’-AAG CTT GGC CGA GAG GGC CGA AAA CGT TCG CGG CCG CGG CCT CTC TGG CCG TTA AC-3’ between the HindIII and HpaI sites (highlighted in italics ...
-
bioRxiv - Immunology 2021Quote: ... Global macrophage depletion was carried out using the homodimerizer AP20187 at 10 mg/kg in carrier solution by subcutaneous injection (Cat. # 635058, Clontech) with carrier-treated controls (4% EtOH ...
-
bioRxiv - Plant Biology 2024Quote: ... equilibrated with 2 μg of anti-GFP antibody (Takara Bio, 632381). Beads were washed for 2 x 10 mins in low salt wash buffer ...
-
bioRxiv - Immunology 2021Quote: ... or RARα403 (RARα-dAF2) 41 with a C-terminal Halo-tag were generated using the In- Fusion Cloning Kit (TaKaRa Bio Inc, Shiga, Japan). Lentiviruses were generated using CSII-EF- MCS-IRES2-Venus (for overexpression) ...
-
bioRxiv - Microbiology 2019Quote: ... 1.5 μg of bait plasmids were added into 100 μl of yeast competent cells with 50 μg of denatured Yeastmaker Carrier DNA (Takara Bio USA, Mountain View, CA) and 500 μl PEG/LiAc ...
-
bioRxiv - Developmental Biology 2024Quote: ... The samples were stained with anti-mouse E-cadherin monoclonal antibody ECCD-2 (1:100, Takara) for 16 h at 4°C ...
-
bioRxiv - Biochemistry 2023Quote: ... The membrane was incubated for 1 h at room temperature with Odyssey blocking buffer and 0.2 % PBS-T (PBS containing 0.2 % (v/v) Tween-20) with rat anti-HA clone 3F primary antibody (Clontech) at 1:1,000 dilution ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 µL of 2 mM dNTPs (Takara #4025), and 0.6 µL of 100% DMSO (NEB #12611P) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 µL of 2 mM dNTPs (Takara #4025), and 0.6 µL of 100% DMSO (NEB #12611P) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 (TaKaRa) and purified using ProbeQuant G-50 Micro Columns (GE Healthcare ...
-
bioRxiv - Neuroscience 2022Quote: ... protein lysate was immunoprecipitated for 2 h at 4°C with the following antibodies: mouse anti-GFP (1:1000; Takara Bio), mouse anti-FLAG (1:1000 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 kit (Takara) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 (Takara, #6045) according to manufacturer’s protocols ...
-
bioRxiv - Immunology 2022Quote: ... version 2 (Takara). Fastq files were generated from bcl files using BCL2FASTQ v2.17.1.14 with default parameters ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 (Takara Bio).
-
bioRxiv - Molecular Biology 2023Quote: ... 2 (Takara Bio).
-
bioRxiv - Developmental Biology 2019Quote: ... 2 mM dithiothreitol (Clontech), 2 μM template switching oligo (Exiqon) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 (Takara, Shiga, Japan) and 0.32 µM of each primer according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... Doxycycline (2 mg/L, Clontech) was also included on d0 to induce TetO gene expression by binding to rtTA and the TetO promoter upstream of the Ngn2 gene ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 µg/ml doxycycline (Takara) was added on day 0 to induce TetO gene expression ...
-
bioRxiv - Cell Biology 2024Quote: ... Ver.2 (Takara, cat# 6233), as per manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2020Quote: ... The primary antibody rabbit anti-human Cas9 Polyclonal Antibody (Clontech) was diluted 1 ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 (TaKaRa bio. Inc., Shiga, Japan). The vector was transformed into XL1-Blue Escherichia coli competent cells (GMbiolab Co. ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 (Dye Plus; TaKaRa, Dalian, Japan), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Lenti-X concentrator (PT4421-2, Clontech) was mixed at the ratio of 1:3 and incubated at 4 °C for a short time ...
-
bioRxiv - Cell Biology 2021Quote: ... and doxycycline (2 mg/ml, Clontech). After 6 hours ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 mM DTT (Takara Bio, #639537), 1 mM dNTPs (Takara Bio ...
-
bioRxiv - Cell Biology 2021Quote: ... containing doxycycline (2 mg/ml, Clontech). We kept the cells in this medium for 5 days ...
-
bioRxiv - Bioengineering 2023Quote: ... 2 µg pantropic pVSV-G (Clontech), 3 µg pCL- (Imgenex) ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 Units of Exonuclease III (Takara) were added to 1ug of NCPs in ExoIII digestion buffer (50 mM Tris– HCl (pH 8.0) ...
-
bioRxiv - Immunology 2023Quote: ... 2 µL 100 µM DTT (Takara), 2 µL 10 µM template switching oligo ...
-
bioRxiv - Immunology 2023Quote: ... version 2 (Takara cat. no. 634411) and mRRBS library preparation was performed using custom procedures previously described by our group (23 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 U recombinant inhibitor (TaKaRa) for samples containing biological inhibitor ...
-
bioRxiv - Microbiology 2022Quote: ... monoclonal antibody (Clontech) and peroxidase-labeled anti-mouse IgG (H + L ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 μL of the RT reaction was combined with 2.5 μL of 10X Advantage 2 buffer (Takara), 2.5 μL of 2.5 mM dNTPs (Takara) ...